Amateur SARS/2019-NCoV RNA Comparison

Here is a rough comparison between the reported genomes of SARS and 2019-nCoV (“Wuhan virus”). This is the output of an old but still interesting ‘alignment’ algorithm called Needleman-Wunsch. In the world of computing we use ‘diff’ for this purpose, DNA has some specific aspects which are incorporated into the alignment algorithms.

Many years ago I wrote a Javascript demonstration of this algorithm, which can be found here. While you could paste the entire viral genomes in there, what follows is the slightly modified output of the nwunsch tool in my Antonie DNA toolset

Below ‘a’ stands for RNA of SARS coronavirus BJ01 (AY278488.2) while ‘b’ corresponds to Wuhan seafood market pneumonia virus isolate Wuhan-Hu-1, complete genome (MN908947.3).

The pleasing news is that my very amateur comparison agrees with what the professional, competent and highly open Chinese scientists reported in the article they are publishing this week, Discovery of a novel coronavirus associated with the recent pneumonia outbreak in humans and its potential bat origin - around 80% identity between SARS and 2019-nCoV.

I am not in any way qualified to opine on what this 80% identity might mean, but I am happy to see how the knowledge of this new virus is being shared so well and so quickly.

In DNA it is common for individual bases to mutate (“SNPs” aka snips), but there are also frequent inserts and deletions (“indels”). In addition sometimes there are large scale upheavals, but that does not appear to be the case here.

Every red dot represents a difference.

Every red dot represents a difference.

As reported by Zheng-Li Shi et al, some parts of the new virus are much more similar to SARS than others. You can find graphs in their paper.

Here goes (if you copy paste this into a text editor it might look better):

Mismatches: 5466
Skews: 16
Inserts: 192
Deletes: 354
Matches: 24067
a: ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAA
b:                    CCAGG AA AAGCCAACCAAC CTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAA
d:                    ===== == ==!========= !======================================

a: AATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAA  TTACTGTCGTTGACA
b: AATCTGTGTAGCTGTCGCTCGGCTGCATGCCTAGTGCACCTACGCAGTATAAACAATAATAAATTTTACTGTCGTTGACA
d: =========!======!=============!========!!===========!!=====!!==  ===============

a: GGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGT
b: AGAAACGAGTAACTCGTCCCTCTTCTGCAGACTGCTTACGGTTTCGTCCGTGTTGCAGTCGATCATCAGCATACCTAGGT
d: !==!==============!!==========!===========================!============!=!======

a: TTCGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTT
b: TTCGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTTCTTGGTGTCAACGAGAAAACACACGTCCAACTCAGTTT
d: =========================================!=!====!===============================

a: GCCTGTTTTACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAAC
b: GCCTGTCCTTCAGGTTAGAGACGTGCTAGTGCGTGGCTTCGGGGACTCTGTGGAAGAGGCCCTATCGGAGGCACGTGAAC
d: ======!!=!======!=!========!==!========!==!=====!=====!====!=!====!=========!===

a: ATCTTAAAGATGGCACTTGTGGCTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATC
b: ACCTCAAAAATGGCACTTGTGGTCTAGTAGAGCTGGAAAAAGGCGTACTGCCCCAGCTTGAACAGCCCTATGTGTTCATT
d: =!==!===!=============!!=======!!=!===========!!====!==!=======================!

a: AAACGTTCGGATGCTCGAACTGCACC  TCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTAC
b: AAACGTTCTGATGC CTTA AGCACCAATCACGGCCACAAGGTCGTTGAGCTGGTTGCAGAAATGGACGGCATTCAGTAC
d: ========!===== =!!= !=====  ===!==!==!!!!!=!===========!======!=!==!============

a: GGTCGTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCTTCTTCG
b: GGTCGTAGCGGTATAACACTGGGAGTACTCGTGCCACATGTGGGCGAAACCCCAATTGCATACCGCAATGTTCTTCTTCG
d: ========!===!!!=====!==!==!==!==!==!=============!!===!=!==!========!===========

a: TAAGAACGGTAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTAAAGTCATTTGACTTAGGCGACGAGCTTGGCA
b: TAAGAACGGTAATAAGGGAGCCGGTGGTCATAGCTATGGCATCGATCTAAAGTCTTATGACTTAGGTGACGAGCTTGGCA
d: ===============!=====!=====!=====!==!===!!============!=!=========!=============

a: CTGATCCTTATGAAGATTTTCAAGAAAACTGGAACACTAAACATAGCAGTGGTGTTAC CCGTGAACTCATGCGTGAGCT
b: CTGATCCCATTGAAGATTATGAACAAAACTGGAACACTAAGCATGGCAGTGGTG CACTCCGTGAACTCACTCGTGAGCT
d: =======!!!========!=!==!================!===!========= !== ===========!!========

a: TAACGGAGGGGCATACACTCGCTATGTCGATAACAACTTCTGTGGCCCTGATGGCTACCCTCTTGAGTGCATTAAAGACC
b: CAATGGAGGTGCAGTCACTCGCTATGTCGACAACAATTTCTGTGGCCCAGATGGGTACCCTCTTGATTGCATCAAAGATT
d: !==!=====!===!!===============!=====!===========!=====!===========!=====!=====!!

a: TTCTAGCACGTGCTGGTAAAGCTTCATGCACTTTGTCCGAACAACTGGACTTTATTGACACTAAGAGGGGTGTATACTGC
b: TTCTCGCACGCGCGGGCAAGTCAATGTGCACTCTTTCCGAACAACTTGATTACATCGAGTCGAAGAGAGGTGTCTACTGC
d: ====!=====!==!==!==!!=!!!!======!=!===========!==!=!!==!==!!=!=====!=====!======

a: TGCCGTGAACATGAGCATGAAATTGCTTGGTACACGGAACGTTCTGAAAAGAGCTATGAATTGCAGACACCTTTTGAAAT
b: TGCCGTGACCATGAGCATGAAATTGCCTGGTTCACTGAGCGCTCTGATAAGAGCTACGAGCACCAGACACCCTTCGAAAT
d: ========!=================!====!===!==!==!=====!========!==!!!!========!==!=====

a: TAA ATTGGCAAAGAAATTTGACACCTTCAATGGGGAATGTCCAAATTTTGTATTTCC CTTAAATTCCATAATCAAGAC
b: TAAGAGT GCCAAGAAATTTGACACTTTCAAAGGGGAATGCCCAAAGTTTGTGTTTCCTCTT AACTCAAAAGTCAA AG
d: === =!= ==!==============!=====!========!=====!=====!===== === ==!==!=!=!==== =!

a: T ATTCAACCAAGGGTTGAAAAGAAAAAGCTTGATGGCTTTATGGGTAGAATTCGATCTGTCTATCCAGTTGCGTCACCA
b: TCATTCAACCACGTGTTGAAAAGAAAAAGACTGAGGGTTTCATGGGGCGTATACGCTCTGTGTACCCTGTTGCATCTCCA
d: = =========!=!===============!!===!==!==!=====!!=!==!==!=====!==!==!=====!==!===

a: AATGAATGCAACCAAATGTGCCTTTCAACTCTCATGAAGTGTGATCATTGTGGTGAAACTTCATGGCAGACGGGCGATTT
b: CAGGAGTGTAACAATATGCACTTGTCTACCTTGATGAAATGTAATCATTGCGATGAAGTTTCATGGCAGACGTGCGACTT
d: !=!==!==!===!=!===!!=!=!==!==!!=!=====!===!=======!=!====!!=============!====!==

a: TGTTAAAGCCACTTGCGAATTTTGTGGCACTGAGAATTTGACTAAAGAAGGTGCCACTACTTGTGGTTACTTACCCCAAA
b: TCTGAAAGCCACTTGTGAACATTGTGGCACTGAAAATTTAGTTATTGAAGGACCTACTACATGTGGGTACCTACCTACTA
d: =!=!===========!===!!============!=====!!!==!!=====!!=!=====!=====!===!====!!!!=

a: ATGCTGTTGTTAAAATTTATTGTCCAGCATGTCACAATTCAGAAGTAGGACCTGAGCATAGTCTTGCCGAATACCATAAT
b: ATGCTGTAGTGAAAATGCCATGTCCTGCCTGTCAAGACCCAGAGATTGGACCTGAGCATAGTGTTGCAGATTATCACAAC
d: =======!==!=====!!!!=====!==!=====!!=!!====!!=!===============!====!==!==!==!==!

a: GAATCTGGC TTGAAAACCATTCTTCGTAAGGGTGGTCGCACTA TTGCCTTTGGAGGCTGTGTGTTCTCTTATGTTGGT
b: CACTCAAACATTG AAACTCGACTCCGCAAGGGAGGTAGGACTAGATG TTTTGGAGGCTGTGTGTTTGCCTATGTTGGC
d: !=!==!!!= === ====!!!!==!==!=====!===!=!==== !== !=================!!=!========!

a: TGCCATAACAAGTGTGCCTATTGGGTTCCACGTGCTAGCGCTAACATAGGTTGTAACCATACAGGTGTTGTTGGAGAAGG
b: TGCTATAATAAGCGTGCCTACTGGGTTCCTCGTGCTAGTGCTGATATTGGCTCAGGCCATACTGGCATTACTGGTG ACA
d: ===!====!===!=======!========!========!===!=!==!==!=!!!!======!==!!==!!===!= =!!

a: TTCCGAAGGTCTT AATGACAACCTTCTTGAAATACTCCAAAAAGAGAAAGTCAACATCAATATTGTTGGTGACTTTAAA
b: ATGTGGAGACCTTGAATGAGGATCTCCTTGAGATACTGAGTCGTGAACGTGTTAACATTAACATTGTTGGCGATTTTCAT
d: !=!!=!==!!=== =====!!=!==!=====!=====!!!!!!!==!!!!==!=====!==!========!==!===!=!

a: CTTAATGAAGAGATCGCCATTATTTTGGCATCTTTTTCTGCTTCCACAAGTGCTTTTGTGGAAACTGTGAAAG GTTTGG
b: TTGAATGAAGAGGTTGCCATCATTTTGGCATCTTTCTCTGCTTCTACAAGTGCCTTTATTGACACTAT AAAGAGTCTTG
d: !=!=========!=!=====!==============!========!========!===!=!==!===!= ==== ==!=!=

a: ATTATAAAGCATTCAAACAAATTGTTGAATCCTGTGGTAATTTTAAAGTTACAAAAGGAAAAGCTAAAAAAGGTGCCTGG
b: ATTACAAGTCTTTCAAAACCATTGTTGAGTCCTGCGGTAACTATAAAGTTACCAAGGGAAAGCCCGTAAAAGGTGCTTGG
d: ====!==!!=!======!!!========!=====!=====!=!=========!==!=====!!=!!!=========!===

a: AATATTGGTGAACAGAAATCAATACTGAGTCCTCTTTATGCATTTGCATCAGAGGCTGCTCGTGTTGTACGATCAATTTT
b: AACATTGGACAACAGAGATCAGTTTTAACACCACTGTGTGGTTTTCCCTCACAGGCTGCTGGTGTTATCAGATCAATTTT
d: ==!=====!!======!====!=!!=!=!!==!==!=!==!!===!=!===!========!=====!=!!==========

a: CTCCCGCACTCTTGAAACTGCTCAAAATTCTGTGCGTGTTTTACAGAAG GCCGCTATAACAATACTAGATGGAATTTCA
b: TGCGCGCACACTTGATGCAGCAAACCACTCAATTCCTGATTTGCA AAGAGCAGCTGTCACCATACTTGATGGTATTTCT
d: !!=!=====!=====!!=!==!!=!!=!==!!=!=!==!===!== === ==!===!=!==!=====!=====!=====!

a: CAGTATTCACTGAGACTCATTGATGCTATGATGTTCACATCTGATTTGGCT ACTAACAATCTAGTTGTAATGGCCTACA
b: GAACAGTCATTACGTCTTGTCGACGCCATGGTTTATACTTCAGACCT GCTCACCAACAGTGTCATTATTATGGCATATG
d: !=!!=!===!=!!=!==!!=!==!==!===!=!=!!==!==!==!!= === ==!====!=!=!!==!=!=====!==!!

a: TTACAGGTGGTGTTGTTCAGTTGACTTCGCAGTGGCTAACTAACATCTTTGGCACTGTTTATGAAAAACTCAAACCCGTC
b: TAACTGGTGGTCTTGTACAACAGACTTCTCAGTGGTTGTCTAATCTTTTGGGCACTACTGTTGAAAAACTCAGGCCTATC
d: =!==!======!====!==!!!======!======!=!!====!!=!==!======!!=!!===========!!==!!==

a: CTTGATTGGCTTGAAGAGAAGTTTAAGGAAGGTGTAGAGTTTCTTAGAGACGGTTGGGAAATTGTTAAATTTATCTCAAC
b: TTTGAATGGATTGAGGCGAAACTTAGTGCAGGAGTTGAATTTCTCAAGGATGCTTGGGAGATTCTCAAATTTCTCATTAC
d: !====!===!====!=!===!!===!!=!===!==!==!=====!=!!==!=!======!===!=!======!==!!!==

a: CTGTGCTTGTGAAATTGTCGGTGGACAAATTGTCA CCTG TGCAAAGGAAATTAAGGAGAGTGTTCAGACATTCTTTAA
b: AGGTGTTTTTGACATCGTCAAGGGTCAAA T ACAGGTTGCTTCAGATAACATCAAGGATTGTGTAAAATGCTTCATTGA
d: !!===!==!===!==!===!!!==!==== = !== !!== =!==!=!!=!==!=====!!====!!=!!!!===!==!=

a: GCTTGTAAATAAATTTTTGGCTTTGTGTGCTGACTCTA TCATTATTGGTGGAGCTAAACTT AAAGCCTTGAATTTAGG
b: TGTTGTTAACAAGGCACTCGAAATGTGCATTGA TCAAGTCACTATCGCTGGCGC AAAGTTGCGATCACTCAACTTAGG
d: !!====!==!==!!!!!=!=!!!====!!!=== ==!= ===!===!=!===!== ===!== !!=!=!!=!==!=====

a: TGAAACATTTGTCACGCACTCAAAGGGATTGTACAGAAAGTGTGTTAAAT CCAGAGAAGAAACTG GCCTACTCATGCC
b: TGAAGTCTTCATCGCTCAAAGCAAGGGACTTTACCGTCAGTGT ATACGTGGCA AGGAGCAGCTGCAACTACTCATGCC
d: ====!!!==!!==!=!==!!!!======!=!===!=!!===== !==!!= !== ==!==!=!=== !!===========

a: TCTAAAAGCCCCAAAAGAAATTATC TTCTTAGAGGGAGAAACACTTCCCACAGAAGTGTTAACAGAGGAAGTTG TCTT
b: TCTTAAGGCACCAAAAGAAGTAACCTTTCTT GAAGGTGATTCACATGACACAGTACTTACCTCTGAGGAGGTTGTTCTC
d: ===!==!==!=========!=!=!= ===== ==!==!==!!===!=!!=====!=!=!!!!!=!=====!==== ===!

a: GAAAACTGGTGATTTACAACCATTAGA ACAACC  TACTAG TGAAGCTGTTGAAGCTCCATTGGTTGGTACACCAGTT
b: AAGAAC GGTGAACTCGAAGCACTCGAGACGCCCGTTGATAGCTTCA CAAATGGAGCT  A TCGTTGGCACACCAGTC
d: !=!=== =====!!=!!==!==!=!== ==!!==  =!!=== =!!= =!!!==!====  = =!=====!========!

a: TGTATTAACGGGCTTATGTTGCTCGAAATCAAAGACACAGAAAAGTACTGTGCCCTTG CACCTAATATGATGGTAACAA
b: TGTGTAAATGGCCTCATGCTCTTAGAGATTAAGGACAAAGAACAATACTGCG CATTGTCTCCTGGTTTACTGGCTACAA
d: ===!=!==!==!==!===!=!!=!==!==!==!====!====!=!=====!= =!=== =!===!!=!=!!===!!====

a: ACAAT ACCTTCACACTCAAAGGCGGTGCACCAA CAAAGGT T ACTTTTGGTGATGACACTGTGATAGAAGTGCAAGG
b: ACAATGTCTTTCGC TTAAAAGGGGGTGCACCAATTAAAGGTGTAACCTTTGGAGAAGATACTGTTTGGGAAGTTCAAGG
d: ===== !=!===!= !=!=====!========== !====== = ==!=====!==!==!=====!!!!=====!=====

a: TTACAAGAGTGTGAATATCACTTTTGAACTTGATGAAAGGATTGATAAAGTACTTAATGAGAAGTGCTCTGCCTATACAG
b: TTACAAGAATGTGAGAATCACATTTGAGCTTGATGAACGTGTTGACAAAGTGCTTAATGAAAAGTGCTCTGTCTACACTG
d: ========!=====!!=====!=====!=========!=!!====!=====!========!==========!===!==!=

a: TTGAACTCGGTACAGAAGTAAATGAGTTCGCCTGTGTTGTGGCAGATGCTGTCATAAAAACTTTGCAACCAGTATCTGAA
b: TTGAATCCGGTACCGAAGTTACTGAGTTTGCATGTGTTGTAGCAGAGGCTGTTGTGAAGACTTTACAACCAGTTTCTGAT
d: =====!!======!=====!=!======!==!========!=====!=====!!=!==!=====!========!=====!

a: TTACTTACACCAC TGGGCATTGATTTAGATGAGTGGAGTATGGCTACATACTACTTATTTGATGAGTCTGGTGAGTTTA
b: CTCCTTAC CAACATGGGTATTGATCTTGATGAGTGGAGTGTAGCTACATTCTACTTATTTGATGATGCTGGTGAAGAAA
d: !=!===== =!== ====!======!=!============!=!=======!===============!!=======!!!!=

a: AATTGGCTTCACATATGTATTGTTCTTTCTACCCTCCAGATGAGGATGAAGA  A GAAGGTGATTGTGAAGAAGAAGAG
b: ACTTTTCATCACGTATGTATTGTTCCTTTTACCCTCCAGATGAGGAAGAAGAGGACGATGCAGAGTGTGAGGAAGAAGAA
d: =!==!!=!====!============!==!=================!=====  = ==!=!!==!=====!========!

a: TTTGAGCCATCAACTCAATATGAGTATGGTACTGAAGATGATTACCAAGGTAAACCTTTGGAATTTGGTGCCACTTCTGC
b: ATTGATGAAACCTGTGAACATGAGTACGGTACAGAGGATGATTATCAAGGTCTCCCTCTGGAATTTGGTGCCTCAGCTGA
d: !====!!!=!=!!!=!==!=======!=====!==!========!======!!!===!==============!=!!===!

a: TGCTCTTCAACCTGAAGAAGAGCAAGAAGAAGATTGGTTAGATGATGATAGTCAACAAACTGTTGGTCAACAAGACGGCA
b: AACAGTTCGAGTTGAGGAAGAAGAAGAGGAAGACTGGCT G  GATG  A T  AC TACTG  AG CAATCAGA  G A
d: !!=!!===!=!!===!=====!!====!=====!===!= =  ====  = =  == !====  != ===!!===  = =

a: GTGAGGACAATCAGACAACTACTATTCAAACAATTGTTGAGGTTCAACCTCAATTAGAGATGGAACTTACACCAGTTGTT
b: TTGA G C   CAG  AAC  C A   GAAC     CT A    C A C C   T GA A  G     A A C       
d: !=== = =   ===  ===  = =   !===     != =    = = = =   = == =  =     = = =       

a: CAGACTATTGAAGTGAATAGTTTTAGTGGTTATTTAAAACTTACTGACAATGTATACATTAAAAATGCAGACATTGTGGA
b: CAG    TT AA T   CAG TTTACTGGTTATTTAAAACTTACTGACAATGTTGCCATTAAATGTGTTGACATCGT TA
d: ===    == == =   !== ====!===========================!!!=======!!==!!=====!== !=

a: AGAAGCTAAAAAG GTAAAACCAACAGTGGTTGTTAATGCAGCCAATGTTTACCTTAAACATGGAGGAGGTGTTGCAGGA
b: AGGAGGCACAAAGTGCTAATCCTATGGTGATTGTAAATGCTGCTAACATACACCTGAAACATGGTGGTGGTGTAGCAGGT
d: ==!==!!=!==== =!!==!==!=!!===!====!=====!==!==!!=!!====!========!==!=====!=====!

a: GCCTTAAATAAGGCTACTAACAATGCCATGCAAGTTGAATCTGATGATTACA T AGCTACTAATGGACCACTTAAAGTG
b: GCACTCAACAAGGCAACCAATGGTGCCATGCAAAAGGAGAGTGATGATTACATTAAGCTA  AATGGCCCTCTTACAGTA
d: ==!!=!==!=====!==!==!!!==========!!!==!!!=========== = =====  =====!==!====!===!

a: GGTGGTAGTTGTGTTTTAAGCGGACACAATCTTGCTAAACACTGTCTTCATGTTGTCGGCCCAAATGTTAACAAAGGTGA
b: GGAGGGTCTTGTTTGCTTTCTGGACATAATCTTGCTAAGAAGTGTCTGCATGTTGTTGGACCTAACCTAAATGCAGGTGA
d: ==!==!!!====!=!!=!!!!=====!===========!!=!=====!========!==!==!==!!=!==!!!======

a: AGACATTCAACTTCTTAAGAGTGCTTATGAAAATTTTAA TCAGCACGAAGTTCTACTTGCACCATTATTATCAGCTGGT
b: GGACATCCAGCTTCTTAAGGCAGCATATGAAAATTTCAATTCA CAGGACATCTTACTTGCACCATTGTTGTCAGCAGGC
d: !=====!==!=========!!!==!===========!== === ==!==!!=!!=============!==!=====!==!

a: ATTTTTGGTGCTGACCCTATACATTCTTTAAGAGTTTGTGTAGATACTGTTCGCACAAATGTCTACTTAGCTGTCTTTGA
b: ATATTTGGTGCTAAACCACTTCAGTCTTTACAAGTGTGCGTGCAGACGGTTCGTACACAGGTTTATATTGCAGTCAATGA
d: ==!=========!=!==!!=!==!======!!===!==!==!!=!==!=====!===!=!==!==!!=!==!===!!===

a: TAAAAATCTCTATGACAAACTTGT TTCAAGCTTTTTG GAA ATGAAGAGTGAAAAGCAAGTTGAACAAAAGATCGCTG
b: CAAAGCTCTTTATGAGCAGGTTGTCATGGATTATCTTGATAACCTGAAGCCTAGAGTGGAAG  CACCTAAACA AGAGG
d: !===!!===!=====!!=!!==== !=!!=!!!=!=== !== !=====!!=!!=!!=!===  !=!=!===!= !=!!=

a: AGATTCCTAAAGAGGAAGTTAAGCCATT TATAACTGA AAGTAAACCTTCAGTTGAACAGAGAAAACAAGATGATAAG 
b: AGCCACC AAACA  CAG  AAG  ATTCCAAAACTGAGGAG AAA   TCTGTCGTACAGAAGCCTGTCGATGTGAAGC
d: ==!!!== ===!=  !==  ===  === !=!====== !== ===   ==!==!=!=====!!!!!!!!====!!=== 

a:   AAAATCAAAGCTTGTGTTGAAGAAGTTACAACAACTCTGGAAGAAACTAAGTTCCTCACAGAAAACTTGTTACTT TA
b: CAAAAATTAAGGCCTGCATTGATGAGGTTACCACAACACTGGAAGAAACTAAGTTTCTTACCAATAAGTTACT CTTGTT
d:   =====!==!==!==!!====!==!=====!=====!=================!==!==!!=!==!==!!= === =!

a: TATTGACATTAATGGCAATCTTCATCCA GATTCTGCCACTCTTG TTAGTGACATTGACATCACTTTCTTAAAGAAAGA
b: TGCTGATATCAATGGTAAGCTTTA CCATGATTCT CAGAACATGCTTAGAGGTGAAGATATGTCTTTCCTTGAGAAGGA
d: =!!===!==!=====!==!===!= === ====== =!!!!=!== ====!=!!!!!==!==!!=====!=!!====!==

a: TGCTCCATATATAGTGGGTGATGTTGTTCAAGAG GGTGTTTTAACTGCTGTGGTTATACCTACTAAAAAGGCTGGTGGC
b: TGCACCTTACATGGTAGGTGATGTT ATCACTAGTGGTGATATCACTTGTGTTGTAATACCCTCCAAAAAGGCTGGTGGC
d: ===!==!==!==!==!========= !===!!== ====!=!=!===!!===!==!=====!!=!===============

a: ACTACTGAAATGCTAGCGAAAGCTTTGAGAAAAGTGCCAACAGACAATTATATAACCACTTACCCGGGTCAGGGTTTAAA
b: ACTACTGAGATGCTCTCAAGAGCTTTGAAGAAAGTGCCAGTTGATGAGTATATAACCACGTACCCTGGACAAGGATGTGC
d: ========!=====!!=!=!========!!=========!!!==!!=!===========!=====!==!==!==!=!!!!

a: TGGTTACACTGTAGAGGAGGCAAAGACAGTGCTTAAAAAGTGTAAAAGTGCCTTTTACATTCTACCATCTATTATC TCT
b: TGGTTATACACTTGAGGAAGCTAAGACTGCTCTTAAGAAATGCAAATCTGCATTTTATGTACTACCTTC AGAAGCACCT
d: ======!==!!=!=====!==!=====!=!!=====!==!==!===!!===!=====!!=!=====!== =!!=!= !==

a: AATGAGAAGCAAGAAATTCTTGGAACTGTTTCTTGGAATTTGCGAGAAATGCTTGCACATGCAGAAGAAACACGCAAATT
b: AATGCTAAGGAAGAGATTCTAGGAACTGTATCCTGGAATTTGAGAGAAATGCTTGCTCATGCTGAAGAGACAAGAAAATT
d: ====!!===!====!=====!========!==!=========!=============!=====!=====!===!=!=====

a: AATGCCTGTCTGTGTGGAAACTAAAGCCATAGTTTCAACTATACAGCGTAAATATAAGGGTATTAAAATACAAGAGGGTG
b: AATGCCTATATGCATGGATGTTAGAGCCATAATGGCAACCATCCAACGTAAGTATAAAGGAATTAAAATTCAAGAGGGCA
d: =======!=!==!!====!!!==!=======!=!!====!==!==!=====!=====!==!========!========!!

a: TGGTTGATTATGGTGCTAGATTTTACTTTTACACCAGTAAAACAACTGTAGCGTCACTTATCAACACACTTAACGATCTA
b: TCGTTGACTATGGTGTCCGATTCTTCTTTTATACTAGTAAAGAGCCTGTAGCTTCTATTATTACGAAGCTGAACTCTCTA
d: =!=====!=======!!!====!=!======!==!======!!!!=======!==!!====!=!!=!!==!===!!====

a: AATGAAACTCTTGTTACAATGCCACTTGGCTATGTAACACATGGCTTAAATTTGGAAGAAGCTGCTCGGTATATGAGATC
b: AATGAGCCGCTTGTCACAATGCCAATTGGTTATGTGACACATGGTTTTAATCTTGAAGAGGCTGCGCGCTGTATGCGTTC
d: =====!!=!=====!=========!====!=====!========!==!===!=!=====!=====!==!=!====!=!==

a: TCTCAAAGTGCCAGCTACAGTTTCTGTTTCTTCACCTGATGCTGTTACAGCGTATAATGGTTATCTTACTTCTTCTTCTA
b: TCTTAAAGCTCCTGCCGTAGTGTCAGTATCATCACCAGATGCTGTTACTACATATAATGGATACCTCACTTCGTCATCAA
d: ===!====!!==!==!!!===!==!==!==!=====!===========!!=!========!==!==!=====!==!==!=

a: AAACACCTGAAGAACATTTTATTGAAACCATCTCACTTGCTGGTTCCTATAAAGATTGGTCCTATTCTGGACAATCTACA
b: AGACATCTGAGGAGCACTTTGTAGAAACAGTTTCTTTGGCTGGCTCTTACAGAGATTGGTCCTATTCAGGACAGCGTACA
d: =!===!====!==!==!===!=!=====!!=!==!!=!=====!==!==!=!===============!=====!!!====

a: CAACTAGGTATAGAATTTCTTAAGAGAGGTGATAAAAGTGTATATTACACT AGTA ATCCTACCAC A TTCCACCTAG
b: GAGTTAGGTGTTGAATTTCTTAAGCGTGGTGACAAAATTGTGTACCACACTCTGGAGAGCC CCGTCGAGTTTCATCTTG
d: !=!!=====!=!============!=!=====!====!===!==!!===== !=!= =!== !=!!= = ==!==!==!=

a: ATGGTGAAGTTATCACCTTTGACAATCTTAAGACACTTCTT TCTTTGAGAGAAGTGAGGACTATTAAGGTGTTTACAAC
b: ACGGTGAGGTTCTTTCACTTGACAAACTAAAGAGTC TCTTATCCCTGCGGGAGGTTAAGACTATAAAAGTGTTCACAAC
d: =!=====!===!=!!=!!=======!==!====!!= ==== ==!!==!=!==!==!=!======!==!=====!=====

a: AGTAGACAACATTAACCTCCACACGCAAGTTGTGGACATGTCAATGACATATGGACAACAGTTTGGTCCAACTTATTTGG
b: TGTGGACAACACTAATCTCCACACACAGCTTGTGGATATGTCTATGACATATGGACAGCAGTTTGGTCCAACATACTTGG
d: !==!=======!===!========!==!!=======!=====!==============!==============!==!====

a: ATGGAGCTGATGTTACTAAAATAAAACCTCATAATTCA CATGAAGGTAAAACATTTTATGTTTTACCTAATGATGACAC
b: ATGGTGCTGATGTTACAAAAATTAAACCTCAT GTAAATCATGAGGGTAAGACTTTCTTTGTACTACCTAGTGATGACAC
d: ====!===========!=====!========= !=!!= =====!=====!==!==!=!===!!======!=========

a: TCTACGTGTTGAGGCTTTTGAGTACTACCACACAACTGATCCTAGTTTTCTGGGTAGGTACATGTCAGCATTAAATCACA
b: ACTACGTAGTGAAGCTTTCGAGTACTACCATACTCTTGATGAGAGTTTTCTTGGTAGGTACATGTCTGCTTTAAACCACA
d: !======!!===!=====!===========!==!!!====!!!========!==============!==!=====!====

a: CTAAAAAGTGGAAATACCCACAAGTTAATGGTTTAACTTCTATTAAATGGGCAGATAACAACTGTTATCTTG CCACTGC
b: CAAAGAAATGGAAATTTCCTCAAGTTGGTGGTTTAACTTCAATTAAATGGGCTGATAACAATTGTTAT TTGTCTAGTGT
d: =!==!==!=======!!==!======!!============!===========!========!====== === =!=!==!

a: ATTGTTAACACTCCAACAAATAGAGTTGAAGTTTAATCCACCTGCTCTACAAGATGCTTATTACAGAGCAAGGGCTGGTG
b: TTTATTAGCACTTCAACAGCTTGAAGTCAAATTCAATGCACCAGCACTTCAAGAGGCTTATTATAGAGCCCGTGCTGGTG
d: !==!===!====!=====!!=!==!!=!==!==!===!====!==!==!=====!========!=====!!=!=======

a: AAGCTGCTAACTTTTGTGCACTTATCTTAGCCTACTGTAATAAGACAGTAGGTGAGTTAGGTGATGTTAGAGAAACAATG
b: ATGCTGCTAACTTTTGTGCACTCATACTCGCTTACAGTAATAAAACTGTTGGCGAGCTTGGTGATGTCAGAGAAACTATG
d: =!====================!==!!=!==!===!=======!==!==!==!===!=!========!========!===

a: AGTTA CTTGTTTCAACATGCCAATTTAGATTCTTGCAAA AGAG TCTTGAACGTGGTGTGTAAAACTTGTGGACA AC
b: ACCCATCTT CTACAGCATGCTAATTTGGAATC TGCAAAGCGAGTTCTT AATGTGGTGTGTAAACATTGTGGTCAGAA
d: =!!!= === !=!==!=====!=====!==!== ====== !=== ==== ==!============!!======!== =!

a: AGCAGACAACCCTTAA GGGTGTAGAAGCTGTTATGTACATGGGCACACTTTCTTATGAACAAT TTAAGAAAGGTGTTC
b: AAC TACTA CCTTAACGGGTGTAGAAGCTGTGATGTATATGGGTACTCTATCTTATG ATAATCTTAAGACAGGTGTTT
d: =!= !==!= ====== ===============!=====!=====!==!==!======= =!=== ======!=======!

a: AGATACCTTGTACGTGTGGTAAACAAGCTACAAAATATCTAGTACAACAGGAGTCACCTTTTGTTATGATGTCAGCACCA
b: CCATTCCATGTGTGTGTGGTCGTGATGCTACACAATATCTAGTACAACAAGAGTCTTCTTTTGTTATGATGTCTGCACCA
d: !!==!==!===!!=======!!!!=!======!================!=====!!================!======

a: CCTGCTCAGTATGAACTTA AGCATGGTACATTTACTTGTGCTAGTGAGTACACTGGTAATTACCAGTGTGGTCACTATA
b: CCTGCTGAGTAT AAATTACAGCAAGGTACATTCTTATGTGCGAATGAGTACACTGGTAACTATCAGTGTGGTCATTACA
d: ======!===== ==!=== ====!========!!!!=====!=!===============!==!===========!==!=

a: AACATATAACTTCTAAAGAAACTTTGTATTGCATAGACGGTGCTTTACTTACAAAGTCCTCAGAATACAAAGGTCCTATT
b: CTCATATAACTGCTAAGGAGACCCTCTATCGTATTGACGGAGCTCACCTTACAAAGATGTCAGAGTACAAAGGACCAGTG
d: !!=========!====!==!==!!=!===!=!==!=====!===!!!=========!!!=====!========!==!!=!

a: ACGGATGTTTTCTACAAAGAAAACA GTTACACAACAACCATAAAACCAGTTACTTATAAATTGGATGGTGTTGTTTGTA
b: ACTGATGTTTTCTAC AAGGAAACATCTTACACTACAACCATCAAGCCTGTGTCGTATAAACTCGATGGAGTTACTTACA
d: ==!============ ===!===== !======!========!==!==!==!!=!======!=!=====!===!!==!!=

a: CAGAAATTGACCCTAAGTTGGACAATTATTATAAGAAAGACAATTCTTATTTCACAGAGCAACCAATTGATCTTGTACCA
b: CAGAGATTGAACCAAAATTGGATGGGTATTATAAAAAGGATAATGCTTACTATACAGAGCAGCCTATAGACCTTGTACCA
d: ====!=====!==!==!=====!!!!========!==!==!===!====!=!!========!==!==!==!=========

a: AACCAACCATATCCAAACGCAAGCTTCGATAATTTTAAGTTTGTATGTGATAATATCAAATTTGCTGATGATTTAAACCA
b: ACTCAACCATTACCAAATGCGAGTTTTGATAATTTCAAACTCACATGTTCTAACACAAAATTTGCTGATGATTTAAATCA
d: =!!=======!!=====!==!==!==!========!==!!=!!!====!!===!=!!====================!==

a: GTTAACTGGTTATAAGAAA CCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGGTGATGTGGTGGCT
b: AATGACAGGCT TCACAAAGCCAGCTTCACGAGAGCTATCTGTCACATTCTTCCCAGACTTGAATGGCGATGTAGTGGCT
d: !!=!==!==!= =!=!=== ==!======!=======!!!!==!=====!=====!=====!=====!=====!======

a: ATTGATTATAAACACTACACACCCTCTTTTAAGAAAGGAGCTAAATTGTTACATAAACCTATTGTTTGGCATGTTAACAA
b: ATTGACTATAGACACTATTCAGCGAGTTTCAAGAAAGGTGCTAAATTACTGCATAAGCCAATTGTTTGGCACATTAACCA
d: =====!====!======!!==!=!!!===!========!========!!=!=====!==!===========!!=====!=

a: TGCAACTAATAAAG CCACGTATAAACCAAATACCTGGTGTATACGTTGTCTTTGGAGCACAAAACCAGTTGAAACATCA
b: GGCTAC AACCAAGACAACGTTCAAACCAAACACTTGGTGTTTACGTTGTCTTTGGAGTACAAAGCCAGTAGATACTTCA
d: !==!== ==!!=== =!====!!========!==!======!================!=====!=====!==!==!===

a: AATTCGTTTGATGTACT GAAGTCAGAGGACGCGCAGGGAATGGATAATCTTGCCTGCGAAGATCTAAAACCAGTCTCTG
b: AATTCATTTGAAGTTCTGGCAGT AGAAGACACACAAGGAATGGACAATCTTGCTTGTGAAAGTCAACAACCCACCTCTG
d: =====!=====!==!== =!=== ===!===!=!==!========!========!==!===!!==!=!====!!!=====

a: AAGAAGTAGTGGAAAATCCTACCATACAGAAAGACGTTCTTGAGTGTAATGTGAAAACTACCGAAGTTGTAGGAGACATT
b: AAGAAGTAGTGGAAAATCCTACCATACAGAAGGAAGTCATAGAGTGTGACGTGAAAACTACCGAAGTTGTAGGCAATGTC
d: ===============================!==!==!!=!======!=!=======================!!=!!=!

a: ATACTTAAACCAGCAAATAATAGTTTAAAAATTACAGAAGAGGTTGGCCACACAGATCTAATGGCTGCTTATGTAGACAA
b: ATACTTAAACCATCAGATGAAGGTGTTAAAGTAACACAAGAGTTAGGTCATGAGGATCTTATGGCTGCTTATGTGGAAAA
d: ============!==!==!=!!==!=!===!=!===!=====!=!==!==!!!!=====!==============!==!==

a: TTCTAGTCTTACTATTAAGAAACCTAATGAATTATCTAGAGTATTAGGTTTGAAAACCCTTGCTACTCATGGTTTAGCTG
b: CACAAGCATTACCATTAAGAAACCTAATGAGCTTTCACTAGCCTTAGGTTTAAAAACAATTGCCACTCATGGTATTGCTG
d: !!=!==!!====!=================!!=!==!!!==!!========!=====!!====!=========!=!====

a: CTGTTAATAGTGTCCCTTGGGATACTATAGCTAATTATGCTAAGCCTTTTCTTAACA AAGTTGTTAGTACAACTACTAA
b: CAATTAATAGTGTTCCTTGGAGTAAAATTTTGGCTTATGTCAAACC ATTCTTAGGACAAGCAGCAATTACAACATCAAA
d: =!!==========!======!!==!!==!!!!!!=====!!==!== !======!!= ===!!=!!=!======!!=!==

a: CATAGTTACACGGTGTTTAAACCGTGTTTGTACTAATTATATGCCTTATTTCTTTACTTTATTGCTACAATTGTGTACTT
b: TTGCGCTAAGAGATTAGCACAACGTGTGTTTAACAATTATATGCCTTATGTGTTTACATTATTGTTCCAATTGTGTACTT
d: !!!!=!==!!!=!=!!!!=!=!=====!=!==!!===============!=!=====!======!=!=============

a: TTACTAGAAGTACAAATTCTAGAATTAAAGCATCTATGCCGACTACTATAGCAAAGAATACTGTTAAGAGTGTCGGTAAA
b: TTACTAAAAGTACCAATTCTAGAATTAGAGCTTCACTACCTACAACTATTGCTAAAAATAGTGTTAAGAGTGTTGCTAAA
d: ======!======!=============!===!==!!=!==!==!=====!==!==!====!============!=!====

a: TTTTGTCTAGA GGCTTCATTTAATTATTTGAAGTCACCTAATTTTTCTAAACTGATAAATATTATAATTTGGTTTTTAC
b: TTATGTTTGGATGCCGGCA TTAATTATGTGAAGTCACCCAAATTTTCTAAATTGTTCACAATCGCTATGTGGCTATTGT
d: ==!===!=!== =!=!!== ========!==========!==!=========!==!=!=!!==!!!!==!===!=!==!!

a: TATTAAGTGTTTGCCTAGGTTCTTTAATCTACTCAACCGCTGCTTTAGGTGTTTTAATGTCTAATTTAGGCATGCCTTCT
b: TGTTAAGTATTTGCTTAGGTTCTCTAATCTGTGTAACTGCTGCTTTTGGTGTACTCTTATCTAATTTTGGTGCTCCTTCT
d: =!======!=====!========!======!!!!===!========!=====!!=!!=!========!==!!!!======

a: TACTGTACTGGTTACAGAGAAGGCTATTTGAACTCTACTAATGTCACTATTGCAACCTACTGTACTGGTTCTATACCTTG
b: TATTGTAATGGCGTTAGAGAATTGTATCTTAATTCGTCTAACGTTACTACTATGGATTTCTGTGAAGGTTCTTTTCCTTG
d: ==!====!===!!!!======!!!===!=!==!==!!====!==!====!=!!!!!!=!====!!!======!=!=====

a: TAGTGTTTGTCTTAGTGGTTTAGATTCTTTAGACACCTATCCTTCTTTAGAAACTATACAAATTACCATTTCATCTTTTA
b: CAGCATTTGTTTAAGTGGATTAGACTCCCTTGATTCTTATCCAGCTCTTGAAACCATTCAGGTGACGATTTCATCGTACA
d: !==!!=====!=!=====!=====!==!!=!==!!=!=====!!==!=!=====!==!==!!=!==!========!=!!=

a: AATGGGATTTAACTGCTTTTGGCTTAGTTGCAGAGTGGTTTTTGGCATATATTCTTTTCACTAGGTTTTTCTATGTACTT
b: AGCTAGACTTGACAATTTTAGGTCTGGCCGCTGAGTGGGTTTTGGCATATATGTTGTTCACAAAATTCTTTTATTTATTA
d: =!!!!==!==!==!!!===!==!!=!=!!==!======!=============!!=!=====!=!!==!==!===!==!=!

a: GGATTGGCTGCAATCATGCAATTGTTTTTCAGCTATTTTGC AGTACATTTTATTAGTAATTCTTGGCTTATGTGGTTAA
b: GGTCTTTCAGCTATAATGCAGGTGTTCTTTGGCTATTTTGCTAGT CATTTCATCAGCAATTCTTGGCTCATGTGGTTTA
d: ==!!=!!=!==!==!=====!!====!==!!========== === =====!==!==!===========!========!=

a: TAATTAATCTTGTACAAATGGC CCCGATTTCAGCTATGGTTAGAATGTACATCTTCTTTGCATCATTTTATTATGTATG
b: TCATTAGTATTGTACAAATGGCACCCG TTTCTGCAATGGTTAGGATGTACATCTTCTTTGCTTCTTTCTACTACATATG
d: =!====!=!============= ==== ====!==!========!=================!==!==!==!==!!====

a: GAAAAGTTATGTGCATGTTGTAGACGGTTGTAATTCATCAACTTGTATGATGTGTTACAAACGTAATAGAGCAACAAGAG
b: GAAGAGCTATGTTCATATCATGGATGGTTGCACCTCTTCGACTTGCATGATGTGCTATAAGCGCAATCGTGCCACACGCG
d: ===!==!=====!===!=!!=!==!=====!=!!==!==!=====!========!==!==!==!===!=!==!===!=!=

a: TCGAATGTACAACTATTGTTAATGGTGTTAGAAGGTCCTTTTATGTCTATGCTAATGGAGGTAAAGGCTTTTGCAA ACT
b: TTGAGTGTACAACTATTGTTAATGGCATGAAGAGATCTTTCTATGTCTATGCAAATGGAGGCCGTGGCTTCTGCAAGACT
d: =!==!====================!!=!=!!==!==!==!===========!========!!!!=====!===== ===

a: ACACAATTGGAATTGTGTTAATTGTGATACATTCTGTGCTGGTAGTACATTTATTAGTGATGAAGTTGCGAGAGACTTGT
b:  CACAATTGGAATTGTCTCAATTGTGACACATTTTGCACTGGTAGTACATTCATTAGTGATGAAGTTGCTCGTGATTTGT
d:  ===============!=!========!=====!==!!=============!=================!!=!==!====

a: CACTACAGTTTAAAAGACCAATAAATCCTACTGACCAGTCTTCTTACATCGTTGATAGTGTTACAGTGAAGAATGGTTCC
b: CACTCCAGTTTAAAAGACCAATCAACCCTACTGACCAGTCATCGTATATTGTTGATAGTGTTGCTGTGAAAAATGGCGCG
d: ====!=================!==!==============!==!==!==!============!=!=====!=====!!=!

a: ATCCATCTTTACTTTGATAAAGCTGGTCAAAAGACTTATGAAAGACATTCTCTCTCTCATTTTGTTAACTTAGACAACCT
b: CTTCACCTCTACTTTGACAAGGCTGGTCAAAAGACCTATGAGAGACATCCGCTCTCCCATTTTGTCAATTTAGACAATTT
d: !=!==!==!========!==!==============!=====!======!=!=====!========!==!========!!=

a: GAGAGCTAATAACACTAAAGGTTCATTGCCTATTAATGTTATAGTTTTTGATGGTAAATCAAAATGTGAAGAATCATCTG
b: GAGAGCTAACAACACTAAAGGTTCACTGCCTATTAATGTCATAGTTTTTGATGGCAAGTCCAAATGCGACGAGTCTGCTT
d: =========!===============!=============!==============!==!==!=====!==!==!==!!==!

a: CAAAATCAGCGTCTGTTTACTACAGTCAGCTTATGTGTCAACCTATACTGTTACTAGATCAGGCATTAGTGTCTGATGTT
b: CTAAGTCTGCTTCTGTGTACTACAGTCAGCTGATGTGCCAACCTATTCTGTTGCTTGACCAAGCTCTTGTATCAGACGTT
d: =!==!==!==!=====!==============!=====!========!=====!==!==!==!==!!=!==!==!==!===

a: GGTGATAGTGCGGAAGTTGCAGTTAAAATGTTTGATGCTTACGTTAATACGTTTTCATCAACTTTTAACGTACCAATGGA
b: GGAGATAGTACTGAAGTTTCCGTTAAGATGTTTGATGCTTATGTCGACACCTTTTCAGCAACTTTTAGTGTTCCTATGGA
d: ==!======!=!======!=!=====!==============!==!!=!==!======!=========!!==!==!=====

a: AAAACTCAAAACACTAGTTGCAACTGCAGA AGCTGAACTTGCAAAGAATGTGTCCTTAGACAATGTCTTATCTACTTTT
b: AAAACTTAAGGCACTTGTTGCTACAGCTCACAGC GAGTTAGCAAAGGGTGTAGCTTTAGATGGTGTCCTTTCTACATTC
d: ======!==!!====!=====!==!==!!= === ==!!=!======!!===!!=!=====!!!====!=!=====!==!

a: ATTTCAGCAGCTCGGCAAGGGTTTGTTGATTCAGATGTAGAAACTAAAGATGTTGTTGAATGTCTTAAATTGTCACATCA
b: GTGTCAGCTGCCCGACAAGGTGTTGTTGATACCGATGTTGACACAAAGGATGTTATTGAATGTCTCAAACTTTCACATCA
d: !=!=====!==!==!=====!!========!=!=====!==!==!==!======!==========!===!=!========

a: ATCTGACATAGAAGTTACTGGCGATAGTTGTAATAACTATATGCTCACCTATAACAAAGTTGAAAACATGACACCCCGTG
b: CTCTGACTTAGAAGTGACAGGTGACAGTTGTAACAATTTCATGCTCACCTATAATAAGGTTGAAAACATGACGCCCAGAG
d: !======!=======!==!==!==!========!==!=!!==============!==!==============!===!=!=

a: ACCTTGGTGCTTGTATTGACTGTAGTGCGCGTCATATTAATGCGCAGGTAGCAAAAAGTCACAACATTGCTTTGATATGG
b: ATCTTGGCGCATGTATTGACTGTAATGCAAGGCATATCAATGCCCAAGTAGCAAAAAGTCACAATGTTTCACTCATCTGG
d: =!=====!==!=============!===!!=!=====!=====!==!=================!!==!=!!=!==!===

a: AACGTTAAAGATTTCATGTCATTGTCTGAACAACTACGAAAACAAATACGTAGTGCTGCTAAAAAGAATAACTTACCTTT
b: AATGTAAAAGACTACATGTCTTTATCTGAACAGCTGCGTAAACAAATTCGTAGTGCTGCCAAGAAGAACAACATACCTTT
d: ==!==!=====!=!======!==!========!==!==!========!===========!==!=====!===!=======

a: TAAGTTGACATGTGCAACTACTAGACAAGTTGTTAATGTTGTAACAACAAAGATAGCACTTAAGGGTGGTAAAATTGTTA
b: TAGACTAACTTGTGCTACAACTAGACAGGTTGTCAATGTCATAACTACTAAAATCTCACTCAAGGGTGGTAAGATTGTTA
d: ==!!!=!==!=====!==!========!=====!=====!!====!==!==!==!!====!===========!=======

a: ATAATTGGTTGAAGCAGTTAATTAAAGTTACACTTGTGTTCCTTTTTGTTGCTGCTATTTTCTATTTAATAACACCTGTT
b: GTACTTGTTTTAAACTTATGCTTAAGGCCACATTATTGTGCGTTCTTGCTGCATTGGTTTGTTATATCGTTATGCCATTA
d: !==!===!==!==!=!!!=!!====!=!!===!=!!===!=!==!===!===!!!!!===!!===!=!!=!=!!==!!=!

a: CATGTCA TGTCTAAACATACTGACTTTTCAAGTGAAATCATAGGATACAAGGCTATTGATGGTGGTGTCACTCGTGACA
b: CAT ACATTGTCAATCCATGATGGTTACACAAATGAAATCATTGGTTACAAAGCCATTCAGGATGGTGTCACTCGTGACA
d: === !== ====!=!!===!!==!!=!!!===!=========!==!=====!==!===!=!=!=================

a: TAGCATCTACAGATACTTGTTTTGCTAACAAACATGCTGATTTTGACACATGGTTTAGCCAGCGTGGTGGTAGTTATACT
b: TCATTTCTACTGATGATTGTTTTGCAAATAAACATGCTGGTTTTGACGCATGGTTTAGCCAGCGTGGTGGTTCATACAAA
d: =!!!!=====!===!!=========!==!==========!=======!=======================!!!==!=!!

a: AATGAC AAAGCTTGCCCATTGATTGCTGCAGTCATAACAAGAGAAGTGGGTTTTGTCGTGCCTGGTTTGCCTGGCACGA
b: AATGACAAAAGC TGCCCTGTAGTAGCTGCTATCATTACAAGAGAGATTGGTTTCATAGTGCCTGGCTTACCGGGTACTG
d: ====== ===== =====!!=!!=!=====!!====!========!!=!=====!!=!========!==!==!==!==!!

a: TATTACGCACAACTAATGGTGACTTTTTGCATTTCTTACCTAGAGTTTTTAGTGCAGTTGGTAACATCTGTTACACACCA
b: TGCTGAGAGCAATCAATGGTGACTTCTTGCATTTTCTACCTCGTGTTTTTAGTGCTGTTGGCAACATTTGCTACACACCT
d: =!!=!!=!!===!!===========!========!!=====!=!===========!=====!=====!==!========!

a: TCAAAACTTATAGAGTACACTGACTTTGCAACATCAGCTTGTGTTTTGGCTGCTGAATGTACAATTTTTAAAGATGCTTC
b: TCCAAACTCATTGAGTATAGTGATTTTGCTACCTCTGCTTGCGTTCTTGCTGCTGAGTGTACAATTTTTAAGGATGCTAT
d: ==!=====!==!=====!=!===!=====!==!==!=====!===!=!========!==============!======!!

a: TGGTAAGCCAGTACCATATTGTTATGATACCAATGTACTAGAAGGTTCTGTTGCTTAT GAAAGTTTACGCCCTGACACA
b: GGGCAAACCTGTGCCATATTGTTATGACACTAATTTGCTAGAGGGTTCTATTTCTTATAGTGAGCTT CGTCCAGACACT
d: !==!==!==!==!==============!==!===!=!=====!======!==!===== =!!==!== ==!==!=====!

a: CGTTATGTGCTCATGGATGGCTCTATTATTCAATTTCCTAACACCTACCTTGAAGGTTCTGTTAGAGTGGTAACAACTTT
b: CGTTATGTGCTTATGGATGGTTCCATCATACAGTTTCCTAACACTTACCTGGAGGGTTCTGTTAGAGTAGTAACAACTTT
d: ===========!========!==!==!==!==!===========!=====!==!==============!===========

a: TGATTCTGAGTACTGTAGGCACGGCACTTGTGAAAGATCAGAAGCTGGTGTTTGTGTATCTACTAGTGGTAGATGGGTAC
b: TGATGCTGAGTACTGTAGACATGGTACATGCGAAAGGTCAGAAGTAGGTATTTGCCTATCTACCAGTGGTAGATGGGTTC
d: ====!=============!==!==!==!==!=====!=======!!===!====!!=======!==============!=

a: TTAACAATGATTATTACAGATCTTTACCAGGAGTTTTCTGTGGTGTAGATGCTGTAAATTTACTTA CTAATATGTTTAC
b: TTAATAATGAGCATTACAGAGCTCTATCAGGAGTTTTCTGTGGTGTTGATGCGATGAATCT CATAGCTAACATCTTTAC
d: ====!=====!!========!==!==!===================!=====!!=!===!= =!== ====!==!=====

a: ACCACTAATTCAACCTATTGGTGCTTTGGACATATCAGCATCTATAGTAGCTGGTGGTATTGTAGCTATCGTAGTAACAT
b: TCCTCTTGTGCAACCTGTGGGTGCTTTAGATGTGTCTGCTTCAGTAGTGGCTGGTGGTATTATTGCCATATTGGTGACTT
d: !==!==!!=!======!=!========!==!!=!==!==!==!!====!============!=!==!==!!=!==!==!=

a: GCCTTGCCTACTATTTTATGAGGTTTAGAAGAGCTTTTGGTGAATACAGTCATGTAGTTGCCTTTAATACTTTACTATTC
b: GTGCTGCCTACTACTTTATGAAATTCAGACGTGCTTTTGGTGAGTACAACCATGTTGTTGCTGCTAATGCACTTTTGTTT
d: =!!!=========!=======!!==!===!=!===========!====!!=====!=====!!!====!=!!=!!=!==!

a: CTTATGTCATTCACTGTACTCTGTTTAACACCAGTTTAC TCATTCTTACCTGGTGTTTATTCTGTTATTTACTTGTACT
b: TTGATGTCTTTCACTATACTCTGTCTGGTACCAGCTTACAGCTTTC TGCCGGGAGTCTACTCAGTCTTTTACTTGTACT
d: !=!=====!======!========!=!!!=====!==== !=!=== =!==!==!==!==!==!==!!============

a: TGACATTTTATCTTACTAATGATGTTTCTTTTTTAGCACATATTCAGTGGATGGTTATGTTCACACCTTTAGTACCTTTC
b: TGACATTCTATTTCACCAATGATGTTTCATTCTTGGCTCACCTTCAATGGTTTGCCATGTTTTCTCCTATTGTGCCTTTT
d: =======!===!=!==!===========!==!==!==!==!!====!===!=!=!!=====!!=!===!=!==!=====!

a: TGGATAACAATTGCTTATATCATT TGTATTTCCACAAAGCATTTCTATTGGTTCTTTAGTAATTACCTAAAGAGACGTG
b: TGGATAACAGCAATCTATGT ATTCTGTATTTCTCTGAAGCACTGCCATTGGTTCTTTAACAACTATCTTAGGAAAAGAG
d: =========!!!!!!===!= === ========!!!!=====!=!=!============!!==!==!==!=!==!=!=!=

a: TAGTCTTTAATGGTGTTTCCTTTAGTACTTTTGAAGAAGCTGCGCTGTGCACCTTTTTGTTAAATAAAGAAATGTATCTA
b: TCATGTTTAATGGAGTTACATTTAGTACCTTCGAGGAGGCTGCTTTGTGTACCTTTTTGCTCAACAAGGAAATGTACCTA
d: =!!=!========!===!=!========!==!==!==!=====!!====!=========!=!==!==!========!===

a: AAGTTGCGTAGTGATGTGCTATTACCTCTTACGCAATATAATAGATA CTTAGCTCTTTATAATAAGTACAAGTATTTTA
b: AAATTGCGTAGCGAGACACTGTTGCCACTTACACAGTATAACAGGTATCTT GCTCTATATAACAAGTACAAGTATTTCA
d: ==!========!==!!!!==!==!==!=====!==!=====!==!== === =====!=====!==============!=

a: GTGGAGCAATGGATACAACTAGCTACAGAGAAGCTGCTTGTTGTCATCTCGCAAAGGCTCTCAATGACTTCAGTAACTCA
b: GTGGAGTCTTAGATACTACCAGCTATCGTGAAGCAGCTTGCTGCCACTTAGCAAAGGCTCTAAATGACTTTAGCAACTCA
d: ======!!!=!=====!==!=====!!=!=====!=====!==!==!!=!===========!========!==!======

a: GGTTCTGATGTTCTTTACCAACCACCACAAACCTCTATCACCTCAGCTGTTTTGCAGAGTGGTTTTAGAAAAATGGCATT
b: GGTGCTGATGTTCTCTACCAACCACCACAGACATCAATCACTTCTGCTGTTCTGCAGAGTGGTTTTAGGAAAATGGCATT
d: ===!==========!==============!==!==!=====!==!======!================!===========

a: CCCATCTGGTAAAGTTGAGGGTTGTATGGTACAAGTAACTTGTGGTACAACTACACTTAACGGTCTTTGGCTTGATGACG
b: CCCGTCAGGCAAAGTTGAAGGGTGCATGGTACAAGTAACCTGTGGAACTACAACTCTTAATGGATTGTGGTTGGATGACA
d: ===!==!==!========!==!==!==============!=====!==!==!==!=====!==!!=!===!=!======!

a: TAGTTTACTGTCCAAGACATGTGATCTGCACCTCTGAAGACATGCTTAACCCTAATTATGAAGATTTACTCATTCGTAAG
b: CAGTATACTGTCCAAGACATGTCATTTGCACAGCAGAAGACATGCTTAATCCTAACTATGAAGATCTGCTCATTCGCAAA
d: !===!=================!==!=====!!=!==============!=====!=========!=!========!==!

a: TCTAATCATA ATTTCTTGGTACAGGCTGGTAATGTTCAACTCAGGGTTATTGGACATTCTATGCAAAATTGTGTACTTA
b: TCCAACCATAGCTTTCTT GTTCAGGCTGGCAATGTTCAACTTCGTGTTATTGGCCATTCTATGCAAAATTGTCTGCTTA
d: ==!==!==== !====== ==!========!===========!!=!========!==================!=!====

a: AGCTTAAGGTTGATACAGCCAATCCTAAGACACCTAAGTATAAGTTTGTTCGCATTCAACCAGGACAGACTTTTTCAGTG
b: GGCTTAAAGTTGATACTTCTAACCCTAAGACACCCAAGTATAAATTTGTCCGTATCCAACCTGGTCAAACATTTTCAGTT
d: !======!========!!=!==!===========!========!=====!==!==!=====!==!==!==!========!

a: TTAGCTTGTTACAATGGTTCACCATCTGGTGTTTACCAATGTGCTATGAGGCCCAATTTCACTATTAAGGGTTCATTCCT
b: CTAGCATGCTACAATGGTTCACCATCTGGTGTTTATCAGTGTGCCATGAGACCTAATCATACCATTAAAGGTTCTTTCCT
d: !====!==!==========================!==!=====!=====!==!===!!!==!=====!=====!=====

a: TAATGGTTCATGTGGTAGTGTTGGTTTTAACATAGATTATGACTGTGTCTCTTTTTGTTACATGCACCATATGGAATTAC
b: TAATGGATCATGTGGTAGTGTTGGTTTTAACATTGATTATGATTGCGTGTCTTTCTGCTATATGCATCATATGGAGCTTC
d: ======!==========================!========!==!==!=====!==!==!=====!========!!=!=

a: CAACTGGAGTTCATGCTGGCACAGACTTAGAAGGTAACTTTTATGGACCTTTTGTTGACAGGCAAACAGCACAAGCAGCT
b: CAACAGGAGTACACGCTGGTACTGACTTAGAAGGTAAATTCTATGGTCCATTTGTTGACAGACAAACTGCACAGGCTGCA
d: ====!=====!==!=====!==!==============!==!=====!==!===========!=====!=====!==!==!

a: GGTACGGACACAACTATTACAGTTAATGTTTTAGCTTGGTTGTACGCTGCTGTTATAAATGGAGACAGGTGGTTTCTCAA
b: GGTACAGACACAACCATAACCTTAAATGTTTTGGCATGGCTGTATGCTGCTGTTATCAATGGTGATAGGTGGTTTCTTAA
d: =====!========!==!==!!=!========!==!===!====!===========!=====!==!===========!==

a: TCGATTTACCACAACTCTTAATGACTTTAACCTTGTGGCTATGAAGTACAATTATGAACCTCTAACACAAGACCATGTTG
b: TAGATTCACCACTACTTTGAATGACTTTAACCTTGTGGCAATGAAGTACAACTATGAACCTTTGACACAAGATCATGTTG
d: =!====!=====!===!=!====================!===========!=========!=!========!=======

a: ACATACTAGGACCTCTTTCTGCTCAAACTGGAATTGCCGTTTTAGATATGTGTGCTTCATTAAAAGAATTACTGCAAAAT
b: ACATATTGGGACCTCTTTCTGCTCAAACAGGAATTGCCGTCTTAGATATGTGTGCTGCTTTGAAAGAGCTGCTGCAGAAT
d: =====!=!====================!===========!===============!=!==!=====!!=!=====!===

a: GGTATGAATGGACGTACCATATTGGGTAGTGCTTTATTAGAAGATGAATTTACACCTTTTGATGTTGTTAGACAATGCTC
b: GGTATGAATGGTCGTACTATCCTTGGTAGCACTATTTTAGAAGATGAGTTTACACCATTTGATGTTGTTAGACAATGCTC
d: ===========!=====!==!!=!=====!!==!=!===========!========!=======================

a: AGGTGTTACTTTCCAAAGTGCAG TGAAAAGAACAATCAAGGGTACACACCACTGGTTGTTACTCACAATTTTGACTTCA
b: TGGTGTTACCTTCCAAGGT AAGTTCAAGAAAATTGTTAAGGGCACTCATCATTGGATGCTTTTAACTTTCTTGACATCA
d: !========!======!== !== =!==!=!==!!!=!=====!==!==!==!===!==!=!!=!==!!=!=====!===

a: CTTTTAGTTTTAGTCCAGAGTACTCAATGGTCTTTGTTCTTTTTTTTGTATGAAAATGCCTTTTTACCTTTTGCTATGGG
b: CTATTGATTCTTGTTCAAAGTACACAGTGGTCACTGTTTTTCTTTGTTTACGAGAATGCTTTCTTGCCATTTACTCTTGG
d: ==!==!!==!=!==!==!=====!==!=====!!====!==!===!=!==!==!=====!==!==!==!===!==!=!==

a: TATTATTGCTATGTCTGCTTTTGCAATGATGTTTGTCAAACATAAGCATGCATTTCTCTGTTTGTTTTTGTTACCTTCTC
b: TATTATGGCAATTGCTGCATGTGCTATGCTGCTTGTTAAGCATAAGCACGCATTCTTGTGCTTGTTTCTGTTACCTTCTC
d: ======!==!==!!====!=!===!===!==!====!==!========!=====!!=!==!======!============

a: TTGCCACTGTAGCTTATTTTAATATGGTCTATATGCCTGCTAGTTGGGTGATGCGTATTATGACATGG TTGGATATGGT
b: TTGCAACAGTTGCTTACTTTAATATGGTCTACATGCCTGCTAGCTGGGTGATGCGTATCATGACATGGCTTGAAT TGGC
d: ====!==!==!=====!==============!===========!==============!========= ===!== ===!

a: TGATACTAGTTTGTCTGGTTTTAAGCTAAAAGACTGTGTTATGTATGCATCAGCTGTAGTGTTACTAATCCTTATGACAG
b: TGACACTAGCTTGTCTGGTTATAGGCTTAAGGATTGTGTTATGTATGCTTCAGCTTTAGTTTTGCTTATTCTCATGACAG
d: ===!=====!==========!==!===!==!==!==============!======!====!==!==!==!==!=======

a: CAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTAT
b: CTCGCACTGTTTATGATGATGCTGCTAGACGTGTTTGGACACTGATGAATGTCATTACACTTGTTTACAAAGTCTACTAT
d: =!!=!=====!==========!======!!=!==!========!=========!=!=====!=====!=====!==!===

a: GGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTA TAATCTCTGTTACTTCTAACTACTCAGGTGTAGTTACAA
b: GGTAATGCTTTAGATCAAGCTATTTCCATGTGGGC CTTAGTTATTTCTGTAACCTCTAACTATTCTGGTGTCGTTACGA
d: ====================!============== ==== =!==!=====!==!========!==!=====!=====!=

a: CTGTCATGTTTTTGGCCAGAGGTATTGTTTTTATGTGTGTTGAGTATTGCCCTATT TTCTTCATAACTGGTAATACACT
b: CTATCATGTTTTTAGCTAGAGCTATAGTGTTTGTGTGTGTTGAGTATTACCC ATTGTTATTTATTACTGGCAACAC CT
d: ==!==========!==!====!===!==!===!===============!=== === ==!==!==!=====!==!== ==

a: T CAGTGTATAATGCTAGTTTATTGTTTCTTAGGCTATTTTTG TACTTGTTACTTTGGCCTCTTTTGTTTACTCAACCG
b: TACAGTGTATCATGCTTGTTTATTGTTTCTTAGGCTATTGTTGCTGC TGCTACTTTGGCCTTTTCTGTTTACTCAACCG
d: = ========!=====!======================!=== =!= ==!===========!==!==============

a: CTACTTTAGACTGACTCTTGGTGTTTATGATTACTTAGTTTCTACACAGGAGTTTAGATATATGAATTCACAGGGACTAC
b: TTACTTCAGGCTTACTCTTGGTGTTTATGACTACTTGGTCTCTACACAAGAATTTAGGTATATGAACTCCCAGGGGCTTT
d: !=====!==!==!=================!=====!==!========!==!=====!========!==!=====!==!!

a: TCCCACCCAAGAATAGCATAGATGCCTTCAAACTCAACATTAAATTGTTGGGTGTTGGTGGCAAACCTTGTATCAAAGTA
b: TGCCTCCTAAGAGTAGTATTGATGCTTTCAAGCTTAACATTAAGTTGTTGGGTATTGGAGGTAAACCATGTATCAAGGTT
d: =!==!==!====!===!==!=====!=====!==!========!=========!====!==!=====!========!==!

a: GCCACTGTACAGTCTAAAATGTCAGATGTAAAGTGCACATCAGTAGTCTTACTCTCAGTTTTGCAACAACTCAGAGTAGA
b: GCTACTGTACAGTCTAAAATGTCTGACGTAAAGTGCACATCTGTGGTACTGCTCTCGGTTCTTCAACAACTTAGAGTAGA
d: ==!====================!==!==============!==!==!!=!=====!===!=!========!========

a: ATCATCATCTAAATTGTGGGCTCAATGTGTCCAGTTACACAATGACATTC TCTTAGCTAAAGATACTACTGAAGCCTTT
b: GTCATCTTCTAAATTGTGGGCACAATGTGTACAACTCCACAATGATATTCTTCTT GCAAAAGACACAACTGAAGCTTTC
d: !=====!==============!========!==!!=!========!==== ==== ==!=====!==!========!==!

a: GAAAAAATGGTTTCACTACTTTCTGTTTTGCTTTCCATGCAGGGTGCTGTAGACATAAACAAGCTTTGTGAAGAAATGCT
b: GAGAAGATGGTTTCTCTTTTGTCTGTTTTGCTATCCATGCAGGGTGCTGTAGACATTAATAGGTTGTGCGAGGAAATGCT
d: ==!==!========!==!!=!===========!=======================!==!=!=!=!==!==!========

a: GGACAACAGGGCAAC CTTACAAGCTATAGCCTCAGAGTTTAGTTCCCTTCCATCATATGCAGCTTTTGCTACTGCTCAA
b: CGATAACCGTGCTACTCTT CAGGCTATTGCTTCAGAATTTAGTTCTTTACCATCATATGCCGCTTATGCCACTGCCCAG
d: !==!===!=!==!== === ==!=====!==!=====!========!!=!===========!====!===!=====!==!

a: GAAGCTTATGAGCAGGCTGTTGCTAATGGTGATTCTGAAGTTGTTCTTAAAAAGTTGAAGAAGTCTTTGAATGTGGCTAA
b: GAGGCCTATGAGCAGGCTGTAGCTAATGGTGATTCTGAAGTCGTTCTCAAAAAGTTAAAGAAATCTTTGAATGTGGCTAA
d: ==!==!==============!====================!=====!========!=====!=================

a: ATCTGAATTTGACCGTGATGCAGCCATGCAACGTAAGTTGGAAAAGATGGCTGATCAAGCTATGACCCAAATGTATAAAC
b: ATCTGAGTTTGACCGTGATGCTGCCATGCAACGCAAGTTGGAAAAGATGGCAGATCAGGCTATGACCCAAATGTACAAAC
d: ======!==============!===========!=================!=====!=================!====

a: AGGCTAGATCTGAGGACAAGAGGGCAAAAGTTACTAGTGCTATGCAGACAATGCTTTTCACTATGCTTAGAAAGTTGGAT
b: AGGCAAGATCTGAGGACAAGAGGGCAAAAGTAACTAGTGCTATGCAAACAATGCTCTTCACTATGCTTAGGAAGCTTGAT
d: ====!==========================!==============!========!==============!===!=!===

a: AATGATGCACTCAACAACATTATCAACAATGCAAGAGATGGTTGTGTTCCCTTGAACATAATACCTCTTACAACAGCAGC
b: AATGATGCACTTAACAACATTATCAACAATGCGCGTGATGGTTGTGTTCCACTCAACATCATACCATTGACTACAGCAGC
d: ===========!====================!!=!==============!!=!=====!=====!!=!==!========

a: CAAACTAATGGTTGTCATACCAGACTATAACACATATAAAAATACGTGTGATGGTACAACATTTACTTATGCATCAGCAT
b: CAAACTCATGGTTGTTGTCCCTGATTATGGTACCTACAAGAACACTTGTGATGGTAACACCTTTACATATGCATCTGCAC
d: ======!========!!=!==!==!===!!!==!==!==!==!==!==========!!==!=====!========!===!

a: TGTGGGAAATCCAACAGGTTGTAGATGCAGATAGTAAAATTGTTCAACTTAGTGAAATTAGTATGGACAATTCACCTAAT
b: TCTGGGAAATCCAGCAAGTTGTTGATGCGGATAGCAAGATTGTTCAACTTAGTGAAATTAACATGGACAATTCACCAAAT
d: =!===========!==!=====!=====!=====!==!======================!!==============!===

a: TTAGCATGGCCTCTTATTGTAACAGCTTTAAGGGCCAATTCTGCTGTCAAATTACAGAATAATGAGCTTAGTCCTGTTGC
b: TTGGCTTGGCCTCTTATTGTTACAGCTCTAAGAGCCAACTCAGCTGTTAAACTACAGAATAATGAACTGAGTCCAGTAGC
d: ==!==!==============!======!====!=====!==!=====!===!=============!==!=====!==!==

a: ACTACGACAGATGTCTTGTGCTGCCGGTACTACACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACTACAACACAA
b: ACTACGACAGATGTCCTGTGCGGCTGGTACCACACAAACAGCTTGTACTGATGACAATGCACTTGCCTACTATAACAATT
d: ===============!=====!==!=====!========!=====!==============!!=!==!=====!====!!!

a: CAAAGGGAGGTAGGTTTGTACTTGCACTGTTATCCGATTTACAGGATTTGAAATGGGCTAGATTCCCTAAGAGTGATGGA
b: CGAAGGGAGGTAGGTTTGTGCTGGCATTACTATCAGACCACCAAGATCTCAAATGGGCTAGATTCCCTAAGAGTGATGGT
d: =!=================!==!===!=!!====!==!!!!==!===!=!=============================!

a: ACTGGTACTATCTATACAGAACTGGAACCACCTTGTAGGTTTGTTACAGACACACCTAAAGGTCCTAAAGTGAAGTATTT
b: ACAGGTACAATTTACACAGAACTGGAACCACCTTGTAGGTTTGTTACAGACACACCAAAAGGGCCTAAAGTGAAATACTT
d: ==!=====!==!==!=========================================!=====!===========!==!==

a: ATACTTTATTAAAGGATTAAACAACCTAAATAGAGGTATGGTACTTGGTAGTTTAGCTGCCACAGTACGTCTACAAGCTG
b: GTACTTCATCAAAGGCTTAAACAACCTAAATAGAGGTATGGTGCTGGGCAGTTTAGCTGCTACAGTACGTCTTCAGGCTG
d: !=====!==!=====!==========================!==!==!===========!===========!==!====

a: GTAATGCAACAGAAGTGCCTGCCAATTCAACTGTATTATCTTTCTGTGCTTTTGCTGTAGATGCTGCTAAAGCTTACAAA
b: GAAATGCTACAGAAGTACCTGCCAATTCAACTGTGCTTTCCTTCTGTGCTTTTGCAGTAGACCCTGCTAAAGCATATAAG
d: =!=====!========!=================!!=!==!==============!=====!!==========!==!==!

a: GATTATCTAGCTAGTGGGGGACAACCAATCACTAATTGTGTTAAGATGTTGTGTACACACACTGGTACTGGTCAGGCAAT
b: GATTACCTAGCAAGTGGAGGACAACCAATCACCAACTGTGTGAAGATGTTGTGTACACACACTGGTACAGGACAGGCAAT
d: =====!=====!=====!==============!==!=====!==========================!==!========

a: AACAGTTACACCGGAAGCCAATATGGATCAAGAATCCTTTGGTGGTGCATCGTGTTGTCTGTACTGCCGTTGCCACATAG
b: TACTGTAACACCAGAAGCTAACATGGACCAAGAGTCCTTTGGTGGTGCTTCATGTTGTCTGTATTGTAGATGCCACATTG
d: !==!==!=====!=====!==!=====!=====!==============!==!===========!==!!=!========!=

a: ATCATCCAAATCCTAAAGGATTTTGTGACTTAAAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTG
b: ACCATCCAAATCCTAAAGGATTCTGTGACTTGAAAGGTAAGTACGTCCAAATACCTACCACTTGTGCTAATGACCCAGTG
d: =!====================!========!===========!==!===========!=================!===

a: GGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGA
b: GGTTTTACACTTAGAAACACAGTCTGTACCGTCTGCGGAATGTGGAAAGGTTATGGCTGTAGTTGTGACCAACTCCGCGA
d: =============!========================!=============================!===========

a: ACCCATGCTTCAGTCAGCTGATGCA CAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCG
b: ACCCTTGATGCAGTCTGCGGATGCATCAA CGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCG
d: ====!==!=!=====!==!====== === ==================================================

a: GCACAGGCACTAGTACTGATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAGTAGCTGGTTTTGCTAAATTCCTA
b: GCACAGGCACTAGTACTGATGTCGTCTACAGGGCTTTTGATATTTACAACGAAAAAGTTGCTGGTTTTGCAAAGTTCCTA
d: =========================!==============!==!=====!==!=====!===========!==!======

a: AAAACTAATTGTTGTCGCTTCCAAGAAAAGGACGAAGATGACAATTTAATTGATTCTTACTTTGTAGTTAAGAGACACAC
b: AAAACTAATTGCTGTCGCTTCCAGGAGAAGGATGAGGAAGGCAATTTATTAGACTCTTACTTTGTAGTTAAGAGGCATAC
d: ===========!===========!==!=====!==!==!=!=======!=!==!====================!==!==

a: TTTCTCTAACTACCAACATGAAGAAACAATTTATAATTTACTTAAGGATTGTCCAGCTGTTGCTAAACATGACTTCTTTA
b: TATGTCTAACTACCAACATGAAGAGACTATTTATAACTTGGTTAAAGATTGTCCAGCGGTTGCTGTCCATGACTTTTTCA
d: =!=!====================!==!========!==!!====!===========!======!!!========!==!=

a: AGTTTAGAATAGACGGTGACATGGTACCACATATATCACGTCAACGTCTTACTAAATACACAATGGCAGACCTCGTCTAT
b: AGTTTAGAGTAGATGGTGACATGGTACCACATATATCACGTCAGCGTCTAACTAAATACACAATGGCTGATTTAGTCTAT
d: ========!====!=============================!=====!=================!==!!=!======

a: GCTTTAAGGCATTTTGATGAAGGTAATTGTGACACATTAAAAGAAATACTTGTCACATACAATTGTTGTGATGATGATTA
b: GCTCTACGTCATTTTGATGAGGGTAATTGTGATACATTAAAAGAAATACTCGTCACATACAATTGCTGTGATGATGATTA
d: ===!==!=!===========!===========!=================!==============!==============

a: TTTCAATAAAAAGGACTGGTATGATTTTGTAGAAAACCCAGATATATTACGCGTATACGCCAACTTAGGTGAACGTGTAC
b: TTTCAATAAGAAGGATTGGTATGACTTCGTAGAGAATCCTGACATCTTACGCGTATATGCTAACTTAGGTGAGCGTGTAC
d: =========!=====!========!==!=====!==!==!==!==!===========!==!===========!=======

a: GCCAAGCTTTGTTAAAAACAGTACAATTCTGTGATGCCATGCGAAATGCTGGTATTGTTGGTGTACTGACATTAGATAAT
b: GCCAATCATTATTAAAGACTGTACAATTCTGCGATGCTATGCGTGATGCAGGCATTGTAGGCGTACTGACATTAGATAAT
d: =====!=!==!=====!==!===========!=====!=====!!====!==!=====!==!==================

a: CAAGATCTCAATGGTAACTGGTATGATTTCGGTGATTTCATACAAACCACGCCAGGTAGTGGAGTTCCTGTTGTAGATTC
b: CAGGATCTTAATGGGAACTGGTACGATTTCGGTGATTTCGTACAAGTAGCACCAGGCTGCGGAGTTCCTATTGTGGATTC
d: ==!=====!=====!========!===============!=====!!!!=!=====!!=!=========!====!=====

a: TTATTATTCATTGTTAATGCCTATATTAACCTTGACCAGGGCTTTAACTGCAGAGTCACATGTTGACACTGACTTAACAA
b: ATATTACTCATTGCTGATGCCCATCCTCACTTTGACTAGGGCATTGGCTGCTGAGTCCCATATGGATGCTGATCTCGCAA
d: !=====!======!=!=====!==!!=!==!=====!=====!==!!====!=====!===!=!==!!====!!=!!===

a: AGCCTTACATTAAGTGGGATTTGTTAAAATATGACTTCACGGAAGAGAGGTTAAAACTCTTTGACCGTTATTTTAAATAT
b: AACCACTTATTAAGTGGGATTTGCTGAAATATGATTTTACGGAAGAGAGACTTTGTCTCTTCGACCGTTATTTTAAATAT
d: =!==!!!!===============!=!========!==!===========!!=!!!!=====!==================

a: TGGGATCAGACATACCACCCAAATTGTGTTAACTGTTTGGATGACAGATGCATTCTGCATTGTGCAAACTTTAATGTTTT
b: TGGGACCAGACATACCATCCCAATTGTATTAACTGTTTGGATGATAGGTGTATCCTTCATTGTGCAAACTTTAATGTGTT
d: =====!===========!==!======!================!==!==!==!==!====================!==

a: ATTCTCTACAGTGTTCCCACCTACAAGTTTTGGACCACTAGTGAGAAAAATATTTGTTGATGGTGTTCCATTTGTAGTTT
b: ATTTTCTACTGTGTTTCCACCTACAAGTTTTGGACCACTAGTAAGAAAAATATTTGTAGATGGTGTTCCTTTTGTTGTTT
d: ===!=====!=====!==========================!==============!===========!=====!====

a: CAACTGGATACCACTTCAGAGAGCTAGGTGTTGTACATAATCAGGATGTAAACTTACATAGCTCTAGACTTAGTTTTAAG
b: CAACTGGATACCATTTTCGTGAGTTAGGAGTCGTACATAATCAGGATGTAAACTTACATAGCTCGCGTCTCAGTTTCAAG
d: =============!==!!=!===!====!==!================================!!=!==!=====!===

a: GAATTACTTGTGTATGCTGCTGACCCTGCTATGCACGCTGCTTCTGGTAATCTATTACTAGATAAACGCACTACGTGCTT
b: GAACTTTTAGTGTATGCTGCTGATCCAGCTATGCATGCAGCTTCTGGCAATTTATTGCTAGATAAACGCACTACATGCTT
d: ===!=!!=!==============!==!========!==!========!===!====!=================!=====

a: TTCAGTAGCTGCACTTACTAACAATGTTGCTTTTCAAACTGTCAAACCCGGTAATTTTAACAAAGACTTCTATGACTTTG
b: TTCAGTAGCTGCACTAACAAACAATGTTGCTTTTCAAACTGTCAAACCCGGTAATTTTAATAAAGACTTTTATGACTTTG
d: ===============!==!=========================================!========!==========

a: CTGTGTCTAAGGGTTTCTTTAAGGAAGGAAGTTCTGTTGAATTAAAACACTTCTTCTTTGCTCAGGATGGTAATGCTGCT
b: CTGTGTCTAAAGGTTTCTTTAAGGAAGGAAGTTCTGTTGAACTAAAACACTTCTTCTTTGCTCAGGATGGCAACGCTGCT
d: ==========!==============================!============================!==!======

a: ATCAGCGATTATGACTACTATCGTTATAATCTACCAACAATGTGTGATATCAGACAACTACTATTTGTAGTTGAAGTTGT
b: ATCAGTGATTATGACTATTATCGTTATAATCTGCCAACAATGTGTGATATCAGACAACTCCTATTCGTAGTTGAAGTTGT
d: =====!===========!==============!==========================!=====!==============

a: TGATAAGTACTTTGATTGTTACGATGGTGGCTGTATTAATGCTAACCAAGTCATCGTCAACAACCTAGACAAATCAGCTG
b: TGATAAATACTTTGATTGTTACGATGGTGGCTGTATTAATGCCAACCAAGTAATCGTTAACAATCTGGATAAATCAGCTG
d: ======!===================================!========!=====!=====!==!==!==========

a: GTTTTCCATTTAATAAATGGGGTAAGGCTAGACTTTATTATGATTCAATGAGTTATGAGGATCAAGATGCACTTTTCGCA
b: GTTTCCCATTTAATAAATGGGGTAAGGCTAGACTTTATTATGACTCAATGAGTTATGAGGATCAAGATGCACTTTTCGCG
d: ====!======================================!===================================!

a: TATACAAAACGTAATGTCATCCCTACTATAACTCAAATGAATCTTAAGTATGCCATTAGTGCAAAGAATAGAGCTCGCAC
b: TATACTAAGCGTAATGTCATCCCTACTATAACTCAAATGAATCTTAAGTATGCCATTAGTGCAAAGAATAGAGCTCGCAC
d: =====!==!=======================================================================

a: CGTAGCTGGTGTCTCTATCTGTAGTACTATGACCAATAGACAGTTTCATCAAAAATTATTGAAATCAATAGCCGCCACTA
b: CGTAGCTGGTGTCTCTATCTGTAGTACTATGACAAATAGACAGTTTCATCAGAAATTATTGAAGTCAATAGCCGCCACTA
d: =================================!=================!===========!================

a: GAGGAGCTACTGTAGTAATTGGAACAAGCAAATTCTATGGTGGTTGGCACAACATGTTAAAAACTGTTTATAGTGATGTA
b: GAGGAGCTACTGTGGTAATTGGAACAAGCAAGTTTTACGGTGGCTGGCATAATATGTTAAAAACTGTTTACAGTGATGTA
d: =============!=================!==!==!=====!=====!==!=================!=========

a: GAAAACCCTCACCTTATGGGTTGGGATTATCCTAAATGTGATAGAGCCATGCCTAACATGCTTAGAATTATGGCCTCACT
b: GAAACTCCACACCTTATGGGTTGGGATTATCCAAAATGTGACAGAGCCATGCCTAACATGCTTAGGATAATGGCCTCTCT
d: ====!!==!=======================!========!=======================!==!========!==

a: TGTTCTTGCTCGCAAACATACAACGTGTTGTAGCTTGTCACACCGTTTCTATAGATTAGCTAATGAGTGTGCTCAAGTAT
b: TGTTCTTGCTCGCAAACATAACACTTGCTGTAACTTATCACACCGTTTCTACAGGTTAGCTAACGAGTGTGCGCAAGTAT
d: ====================!!==!==!====!===!==============!==!========!========!=======

a: TGAGTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCACAACTGCTTAT
b: TAAGTGAGATGGTCATGTGTGGCGGCTCACTATATGTTAAACCAGGTGGAACATCATCCGGTGATGCTACAACTGCTTAT
d: =!=====!=================!==========================!=====!==!=====!============

a: GCTAATAGTGTTTTTAACATTTGTCAAGCTGTCACGGCCAATGTTAATGCACTTTTATCTACTGATGGTAACAAAATTGC
b: GCTAATAGTGTCTTTAACATTTGTCAAGCTGTTACAGCCAATGTAAATGCACTTCTTTCAACTGATGGTAATAAGATAGC
d: ===========!====================!==!========!=========!=!==!===========!==!==!==

a: CGATAAGTATGTCCGCAATTTACAACACAGACTTTATGAGTGTCTCTATAGAAATAGAGATGTTGA CACAGACTTTGTG
b: TGACAAGTATGTCCGCAATCTACAACACAGGCTCTATGAGTGTCTCTATAGAAATAGGGATGTTGATCA TGAATTCGTG
d: !==!===============!==========!==!=======================!======== == !==!==!===

a: AATGAGTTTTACGCATATTTGCGTAAACATTTCTCAATGATGATACTCTCTGACGATGCTGTTGTGTGTTTCAATAGCAC
b: GATGAGTTTTACGCTTACCTGCGTAAACATTTCTCCATGATGATTCTTTCTGATGATGCCGTTGTGTGCTATAACAGTAA
d: !=============!==!!================!========!==!=====!=====!========!=!!==!==!=!

a: TTATGCATCTCAAGGTCTAGTGGCTAGCATAAAGAACTTTAAGTCAGTTCTTTATTATCAAAACAATGTTTTTATGTCTG
b: CTATGCGGCTCAAGGTTTAGTAGCTAGCATTAAGAACTTTAAGGCAGTTCTTTATTATCAAAATAATGTGTTCATGTCTG
d: !=====!!========!====!========!============!===================!=====!==!=======

a: AAGCAAAATGTTGGACTGAGACTGACCTTACTAAAGGACCTCATGAATTTTGCTCTCAACATACAATGCTAGTTAAACAG
b: AGGCAAAATGTTGGACTGAGACTGACCTTACTAAAGGACCTCACGAATTTTGCTCACAGCATACAATGCTAGTTAAACAA
d: =!=========================================!===========!==!====================!

a: GGTGATGATTATGTGTACCTTCCTTACCCAGATCCATCAAGAATCCTAGGGGCCGGCTGTTTTGTAGATGATATCGTAAA
b: GGAGATGATTACGTGTACCTGCCTTACCCAGATCCATCAAGAATATTAGGCGCAGGCTGTTTTGTCGATGATATTGTCAA
d: ==!========!========!=======================!!====!==!===========!========!==!==

a: AACAGATGGTACACTTATGATTGAACGGTTCGTGTCTTTAGCTATAGATGCTTACCCACTTACTAAACATCCTAATCAGG
b: AACAGATGGTACACTTATGATTGAAAGGTTCGTGTCACTGGCTATTGATGCTTACCCACTTACAAAACATCCTAATCAGG
d: =========================!==========!!=!=====!=================!================

a: AGTATGCTGATGTCTTTCATTTGTACTTACAATACATAAGAAAGCTACATGATGAGTTAACAGGACACATGTTAGACATG
b: AGTATGCTGATGTCTTTCACTTGTATTTACAATACATTAGAAAGTTACATGATGAGCTTACTGGCCACATGTTGGACATG
d: ===================!=====!===========!======!===========!=!==!==!========!======

a: TATTCTGTTATGCTTACTAATGATAACACTTCAAGGTATTGGGAACCTGAGTTTTATGAGGCTATGTACACACCGCATAC
b: TATTCCGTAATGCTAACTAATGATAACACCTCACGGTACTGGGAACCTGAGTTTTATGAGGCTATGTACACACCACATAC
d: =====!==!=====!==============!===!====!===================================!=====

a: AGTCTTACAGGCTGTTGGGGCTTGTGTTCTTTGCAATTCACAGACTTCATTAAGATGTGGTGCTTGCATACGTAGACCAT
b: AGTCTTGCAGGCTGTAGGTGCTTGTGTATTGTGCAATTCACAGACTTCACTTCGTTGCGGTGCCTGTATTAGGAGACCAT
d: ======!========!==!========!!=!==================!=!!=!==!=====!==!==!!=!=======

a: TCTTATGTTGTAAATGCTGTTACGACCATGTCATATCAACATCACATAAATTAGTCTTGTCTGTTAATCCGTATGTTTGC
b: TCCTATGTTGCAAGTGCTGCTATGACCATGTCATTTCAACATCACACAAATTAGTGTTGTCTGTTAATCCCTATGTTTGC
d: ==!=======!==!=====!==!===========!===========!========!==============!=========

a: AATGCTCCAGGTTGTGATGTCACAGATGTGACTCAACTTTACTTAGGAGGTATGAGCTATTATTGTAAATCACATAAACC
b: AATGCCCCAGGTTGTGATGTCACTGATGTGACACAACTGTATCTAGGAGGTATGAGCTATTATTGCAAGTCACATAAGCC
d: =====!=================!========!=====!==!!======================!==!========!==

a: ACCCATTAGTTTTCCATTGTGTGCTAATGGACAAGTTTTTGGTTTATATAAAAATACATGTGTTGGTAGCGATAATGTTA
b: TCCCATTAGTTTTCCATTATGTGCTAATGGTCAGGTTTTTGGTTTATACAAAAACACATGTGTAGGCAGTGACAATGTCA
d: !=================!===========!==!==============!=====!========!==!==!==!=====!=

a: CTGACTTTAATGCAATTGCAACATGTGACTGGACAAATGCTGGTGATTACATTTTAGCTAACACCTGTACTGAAAGACTC
b: CTGACTTCAATGCGATAGCAACATGTGATTGGACTAATGCTGGCGATTACATACTTGCCAACACTTGTACTGAGAGACTC
d: =======!=====!==!===========!=====!========!========!!=!==!=====!========!======

a: AAGCTTTTTGCAGCAGAAACGCTCAAAGCTACTGAGGAGACATTTAAACTGTCTTATGGTATTGCTACTGTACGTGAAGT
b: AAGCTTTTCGCAGCAGAAACGCTCAAAGCCACTGAGGAAACATTTAAGCTGTCATATGGTATTGCCACTGTACGCGAAGT
d: ========!====================!========!========!=====!===========!========!=====

a: GCTGTCTGACAGAGAATTACATCTTTCATGGGAAGTTGGTAAACCTAGACCACCACTTAACCGAAATTATGTCTTTACTG
b: ACTCTCTGACAGAGAATTGCATCTTTCATGGGAGGTTGGAAAACCTAGACCACCATTGAACAGAAACTATGTCTTTACTG
d: !==!==============!==============!=====!===============!=!===!====!=============

a: GTTATCGTGTAACTAAAAACAGTAAAGTACAAATAGGAGAGTACACCTTTGAAAAAGGTGACTATGGTGATGCTGTTGTT
b: GTTACCGTGTAACTAAAAATAGTAAAGTACAGATTGGAGAGTACACCTTTGAAAAAGGTGACTATGGTGATGCTGTTGTG
d: ====!==============!===========!==!============================================!

a: TACCGAGGTACAACAACTTACAAATTAAATGTTGGTGATTATTTTGTGCTGACATCACATACAGTAATGCCATTAAGTGC
b: TACAGAGGTACTACGACATACAAGTTGAATGTTGGTGATTACTTTGTGTTGACATCTCACACTGTAATGCCACTTAGTGC
d: ===!=======!==!==!=====!==!==============!======!=======!==!==!=========!=!=====

a: ACCTACACTAGTGCCACAAGAGCACTATGTTAGAATTACTGGCTTATACCCAACACTCAATATCTCAGATGAGTTTTCTA
b: ACCTACTCTAGTGCCACAAGAGCACTATGTGAGAATTACTGGCTTGTACCCAACACTCAACATCTCAGATGAGTTTTCTA
d: ======!=======================!==============!==============!===================

a: GCAATGTTGCAAATTATCAAAAGGTTGGTATGCAAAAGTATTCTACACTCCAGGGACCACCTGGTACTGGTAAGAGTCAT
b: GCAATGTTGCAAATTATCAAAAGGTCGGCATGCAAAAGTACTCTACACTCCAAGGACCACCTGGTACTGGTAAGAGTCAT
d: =========================!==!===========!===========!===========================

a: TTTGCTATTGGCCTAGCTCTCTACTACCCTTCTGCTCGCATAGTGTATACAGCTTGCTCTCATGCCGCTGTTGATGCACT
b: TTTGCCATCGGACTTGCTCTCTATTACCCATCTGCTCGCATAGTGTATACGGCATGCTCTCATGCAGCTGTTGATGCCCT
d: =====!==!==!==!========!=====!====================!==!===========!===========!==

a: ATGTGAGAAGGCATTAAAATATTTGCCTATAGATAAATGTAGTAGAATTATACCTGCACGTGCTCGTGTAGAGTGTTTTG
b: ATGTGAAAAGGCATTAAAATATTTGCCCATAGATAAATGTAGTAGAATCATACCTGCGCGTGCGCGCGTAGAGTGTTTTG
d: ======!====================!====================!========!=====!==!=============

a: ATAAATTCAAAGTGAATTCAACATTAGAACAGTATGTCTTTTGTACTGTAAATGCATTGCCTGAGACGACAGCAGATATA
b: ATAAATTCAAAGTGAATTCAACACTAGAACAGTATGTTTTCTGCACTGTAAATGCATTGCCAGAAACAACTGCTGACATT
d: =======================!=============!==!==!=================!==!==!==!==!==!==!

a: GTTGTCTTTGATGAAATTTCAATGGCCACAAATTATGATTTGAGTGTTGTCAATGCCAGATTACGTGCTAAGCACTATGT
b: GTAGTCTTTGATGAAATCTCTATGGCTACTAATTATGACTTGAGTGTTGTCAATGCTAGACTTCGTGCAAAACACTACGT
d: ==!==============!==!=====!==!========!=================!===!=!=====!==!=====!==

a: GTACATTGGCGACCCTGCTCAATTACCTGCACCACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATT
b: CTATATTGGCGATCCTGCTCAATTACCAGCCCCCCGCACATTGCTGACTAAAGGCACACTAGAACCAGAATATTTTAATT
d: !==!========!==============!==!==!===========!=====!=======================!====

a: CAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTGCTGAAATTGTTGAC
b: CAGTGTGCAGACTTATGAAAACAATAGGTCCAGACATGTTCCTTGGAACTTGTCGCCGTTGTCCTGCTGAAATTGTTGAC
d: =======!==============!====================!===========!========================

a: ACTGTGAGTGCTTTGGTTTATGATAATAAGCTTAAAGCACATAAAGACAAATCAGCTCAATGCTTTAAAATGTTTTATAA
b: ACTGTGAGTGCTTTAGTTTATGACAATAAGCTAAAAGCACACAAGGAGAAGTCAGCTCAATGCTTCAAAATGTTCTACAA
d: ==============!========!========!========!==!==!==!==============!========!==!==

a: GGGTGTTATCACGCATGATGTTTCATCTGCAATTAACAGGCCACAAATAGGCGTGGTAAGAGAATTCCTTACACGTAACC
b: AGGTGTTATTACACATGATGTTTCATCTGCAATCAACAGACCTCAAATAGGCGTTGTAAGAGAATTTCTTACACGCAATC
d: !========!==!====================!=====!==!===========!===========!========!==!=

a: CTGCTTGGAGAAAAGCTGTCTTTATTTCACCTTATAATTCACAGAATGCTGTAGCCTCAAAGATTTTGGGACTACCAACT
b: CTGCTTGGAGAAAAGCTGTTTTTATCTCACCTTATAATTCACAGAACGCTGTAGCTTCAAAAATCTTAGGATTGCCTACG
d: ===================!=====!====================!========!=====!==!==!===!=!==!==!

a: CAAACTGTTGATTCATCACAGGGCTCAGAATATGACTATGTCATATTCACTCAAACCACTGAAACAGCTCACTCTTGTAA
b: CAGACTGTTGATTCATCACAGGGTTCTGAATATGACTATGTCATATTCACACAAACTACTGAAACAGCACACTCTTGTAA
d: ==!====================!==!=======================!=====!===========!===========

a: TGTAAACAGATTTAATGTTGCTATTACCAGAGCAAAAGTAGGCATACTTTGCATAATGTCTGATAGAGACCTTTATGACA
b: TGTCAACCGCTTCAATGTGGCTATCACAAGGGCAAAAATTGGCATTTTGTGCATAATGTCTGATAGAGATCTTTATGACA
d: ===!===!=!==!=====!=====!==!==!======!=!=====!!=!====================!==========

a: AGTTGCAATTTACAAGTCTTGAAATTCCACGTAGGAATGTGGCAACTTTACAAGCTGAAAATGTAACAGGACTCTTTAAA
b: AACTGCAATTTACAAGTCTAGAAATACCACGTCGCAATGTGGCTACATTACAAGCAGAAAATGTAACTGGACTTTTTAAG
d: =!!================!=====!======!=!========!==!========!===========!=====!=====!

a: GATTGTAGTAAGGTAATCACTGGGTTACATCCTACACAGGCACCTACACACCTCAGTGTTGACACTAAA TTCAAAACTG
b: GACTGTAGTAAGATCATTACTGGTCTTCATCCTACACAGGCACCTACACACCTCAGCGTTGATA TAAAGTTCAAGACTG
d: ==!=========!=!==!=====!!=!=============================!=====!= ==== =====!====

a: AAGGTTTATGTGTTGACATACCTGGCATACCTAAGGACATGACCTATAGAAGACTCATCTCTATGATGGGTTTTAAAATG
b: AAGGATTATGTGTTGACATACCAGGCATACCAAAGGACATGACCTACCGTAGACTCATCTCTATGATGGGTTTCAAAATG
d: ====!=================!========!==============!!=!=======================!======

a: AATTATCAAGTTAATGGTTACCCTAACATGTTTATCACCCGCGAAGAAGCTATAAGACATGTACGTGCATGGATTGGCTT
b: AATTACCAAGTCAATGGTTACCCTAATATGTTTATCACCCGCGAAGAAGCTATTCGTCACGTTCGTGCGTGGATTGGCTT
d: =====!=====!==============!==========================!!=!==!==!=====!===========

a: CGATGTCGAGGGGTGTCATGCTACTAGAGAAGCTGTTGGTACCAATTTACCTTTACAGCTAGGTTTTTCTACAGGTGTTA
b: TGATGTAGAGGGCTGTCATGCAACTAGAGATGCTGTGGGTACTAACCTACCTCTCCAGCTAGGATTTTCTACAGGTGTTA
d: !=====!=====!========!========!=====!=====!==!!=====!=!========!================

a: ACCTAGTTGCTGTACCTACAGGTTATGTTGATACACCTAATAATACAGATTTTTCCAGAGTTAGTGCTAAACCACCGCCT
b: ACTTAGTAGCTGTACCGACTGGTTATGTTGACACTGAAAATAACACAGAATTCACCAGAGTTAATGCAAAACCTCCACCA
d: ==!====!========!==!===========!==!!!!=====!=====!==!!=========!===!=====!==!==!

a: GGAGATCAATTTAAACACCTCATACCACTTATGTACAAAGGACTT CCTTGGAATGTAGTGCGTATAAAGATTGTACAAA
b: GGTGACCAGTTTAAACATCTTATACCACTCATGTATAAAGG CTTGCCCTGGAATGTAGTGCGTATTAAGATAGTACAAA
d: ==!==!==!========!==!========!=====!===== === ==!=================!=====!=======

a: TGTTAAGTGACACACTTAAA AATCTCTCTGACAGAGTCGTATTTGTCTTATGGGCACATGGCTTTGAGTTGACATCTAT
b: TGCTCAGTGATACACTGAAAGGAT TGTCAGACAGAGTCGTGTTCGTCCTTTGGGCGCATGGCTTTGAGCTTACATCAAT
d: ==!=!=====!=====!=== !== =!==!===========!==!===!=!=====!============!=!=====!==

a: GAAGTATTTTGTGAAAATAGGACCTGAGCGCACCTGTTGTCTATGTGATAGACGTGCCACATGCTTTTCCACTGCTTCAG
b: GAAGTACTTTGTCAAGATTGGACCTGAAAGAACGTGTTGTCTGTGTGACAAACGTGCAACTTGCTTTTCTACTTCATCAG
d: ======!=====!==!==!========!!=!==!========!=====!=!======!==!========!===!=!====

a: ACACTTATGCCTGTTGGCATCATTCTATTGGATTTGATTACGTCTATAATCCGTTTATGATTGATGTTCAACAATGGGGT
b: ATACTTATGCCTGCTGGAATCATTCTGTGGGTTTTGACTATGTCTATAACCCATTTATGATTGATGTTCAGCAGTGGGGC
d: =!===========!===!========!=!==!=====!==!========!==!=================!==!=====!

a: TTTACAGGTAACCTACAAAGCAACCATGATCTGTATTGTCAAGTCCATGGTAATGCACATGTAGCTAGTTGTGATGCAAT
b: TTTACGGGTAACCTTCAGAGTAACCATGACCAACATTGCCAGGTACATGGAAATGCACATGTGGCTAGTTGTGATGCTAT
d: =====!========!==!==!========!=!!!====!==!==!=====!===========!==============!==

a: CATGACTAGGTGTCTAGCTGTCCACGAGTGCTTTGTTAAGCGTGTTGACTGGACTATTGAATATCCTATAATTGGTGATG
b: CATGACTAGATGTTTAGCAGTCCATGAGTGCTTTGTTAAGCGCGTTGATTGGTCTGTTGAATACCCTATTATAGGAGATG
d: =========!===!====!=====!=================!=====!===!==!=======!=====!==!==!====

a: AACTGAAGATTAATGCGGCTTGTAGAAAGGTTCAACACATGGTTGTTAAAGCTGCATTATTAGCAGACAAATTCCCAGTT
b: AACTGAGGGTTAATTCTGCTTGCAGAAAAGTACAACACATGGTTGTGAAGTCTGCATTGCTTGCTGATAAGTTTCCAGTT
d: ======!=!=====!=!=====!=====!==!==============!==!!=======!!=!==!==!==!==!======

a: CTTCACGACATTGGTAACCCTAAAGCTATTAAGTGTGTACCTCAAGCTGATGTAGAATGGAAGTTCTATGATGCACAGCC
b: CTTCATGACATTGGAAATCCAAAGGCTATCAAGTGTGTGCCTCAGGCTGAAGTAGAATGGAAGTTCTACGATGCTCAGCC
d: =====!========!==!==!==!=====!========!=====!=====!=================!=====!=====

a: TTGTAGTGACAAAGCTTATAAAATAGAAGAATTATTCTATTCTTATGCCACACATTCTGACAAATTCACAGATGGTGTAT
b: ATGTAGTGACAAAGCTTACAAAATAGAGGAACTCTTCTATTCTTATGCTACACATCACGATAAATTCACTGATGGTGTTT
d: !=================!========!===!=!==============!======!!!==!========!========!=

a: GCCTATTTTGGAATTGCAATGTCGATAGATATCCTGCTAATTCCATTGTTTGTAGATTTGACACTAGAGTGCTATCTAAC
b: GTTTGTTTTGGAATTGTAACGTTGATCGTTACCCAGCCAATGCAATTGTGTGTAGGTTTGACACAAGAGTCTTGTCAAAC
d: =!!=!===========!==!==!===!=!==!==!==!===!=!=====!=====!========!=====!!=!==!===

a: CTTAACTTGCCTGGTTGTGATGGTGGCAGTTTGTATGTAAATAAACATGCATTCCACACACCAGCTTTTGATAAAAGTGC
b: TTGAACTTACCAGGCTGTGATGGTGGTAGTTTGTATGTGAATAAGCATGCATTCCACACTCCAGCTTTCGATAAAAGTGC
d: !=!=====!==!==!===========!===========!=====!==============!========!===========

a: TTTTGTTAATTTAAAACAATTACCATTTTTCTATTACTCTGACAGTCCATGTGAGTCTCATGGAAAACAAGTAGTGTCAG
b: ATTTACTAATTTAAAGCAATTGCCTTTCTTTTACTATTCTGATAGTCCTTGTGAGTCTCATGGCAAACAAGTAGTGTCGG
d: !===!!=========!=====!==!==!==!==!==!=====!=====!==============!==============!=

a: ATATAGATTATGTACCACTAAAGTCTGCTACGTGTATAACACGTTGCAATTTAGGTGGTGCTGTCTGTAGACATCATGCT
b: ATATTGATTATGTTCCACTCAAATCTGCTACGTGTATTACACGATGCAATTTAGGTGGTGCTGTTTGCAGACACCATGCA
d: ====!========!=====!==!==============!=====!====================!==!=====!=====!

a: AATGAGTACAGATTGTATCTCGATGCTTATAACATGATGATCTCAGCTGGCTTTAGCTTGTGGGTTTACAAACAATTTGA
b: AATGAGTACCGACAGTACTTGGATGCATATAATATGATGATTTCTGCTGGATTTAGCCTATGGATTTACAAACAATTTGA
d: =========!==!!===!!=!=====!=====!========!==!=====!======!=!===!================

a: TACTTATAACCTCTGGAACACTTTTACAAGACTTCAGAGTTTAGAAAATGTGGCTTTTAATGTTGTAAATAAGGGACACT
b: TACTTATAACCTGTGGAATACATTTACCAGGTTACAGAGTTTAGAAAATGTGGCTTATAATGTTGTTAATAAAGGACACT
d: ============!=====!==!=====!==!!=!======================!=========!=====!=======

a: TTGATGGACAACAGGGTGAAGTACCAGTTTCTATCATTAATAACACTGTTTACACAAAAGTTGATGGTGTTGATGTAGAA
b: TTGATGGACACGCCGGCGAAGCACCTGTTTCCATCATTAATAATGCTGTTTACACAAAGGTAGATGGTATTGATGTGGAG
d: ==========!!!!==!====!===!=====!===========!!=============!==!======!=======!==!

a: TTGTTTGAAAATAAAACAACATTACCTGTTAATGTAGCATTTGAGCTTTGGGCTAAGCGCAACATTAAACCAGTACCAGA
b: ATCTTTGAAAATAAGACAACACTTCCTGTTAATGTTGCATTTGAGCTTTGGGCTAAGCGTAACATTAAACCAGTGCCAGA
d: !=!===========!======!=!===========!=======================!==============!=====

a: GGTGAAAATACTCAATAATTTGGGTGTGGACATTGCTGCTAATACTGTGATCTGGGACTACAAAAGAGATGCTCCAGCAC
b: GATTAAGATACTCAATAATTTGGGTGTTGATATCGCTGCTAATACTGTAATCTGGGACTACAAAAGAGAAGCCCCAGCAC
d: =!=!==!====================!==!==!==============!====================!==!=======

a: ATATATCTACTATTGGTGTTTGTTCTATGACTGACATAGCCAAGAAACCAACTGAAACGATTTGTGCACCACTCACTGTC
b: ATGTGTCTACAATAGGTGTCTGCACAATGACTGACATTGCCAAGAAACCTACTGAGAGTGCTTGTTCTTCACTTACTGTC
d: ==!=!=====!==!=====!==!!=!===========!===========!=====!=!!!!====!=!!====!======

a: TTTTTTGATGGTAGAGTTGATGGTCAAGTAGACTTATTTAGAAATGCCCGTAATGGTGTTCTTATTACAGAAGGTAGTGT
b: TTGTTTGATGGTAGAGTGGAAGGACAGGTAGACCTTTTTAGAAACGCCCGTAATGGTGTTTTAATAACAGAAGGTTCAGT
d: ==!==============!==!==!==!======!=!========!===============!=!==!=========!!!==

a: TAAAGGTTTACAACCATCTGTAGGTCCCA AACAAGCTAGTCTTAATGGAGTCACATTAATTGGAGAAGCCGTAAAAACA
b: CAAAGGTCTAACACCTTC AAAGGGACCAGCACAAGCTAGCGTCAATGGAGTCACATTAATTGGAGAATCAGTAAAAACA
d: !======!==!!===!== !!===!!=== !=========!!=!========================!=!=========

a: CAGTTCAATTATTATAAGAAAGTTGATGGTGTTGTCCAACAATTACCTGAAACTTACTTTACTCAGAGTAGAAATTTACA
b: CAGTTTAACTACTTTAAGAAAGTAGACGGCATTATTCAACAGTTGCCTGAAACCTACTTTACTCAGAGCAGAGACTTAGA
d: =====!==!==!=!=========!==!==!!==!=!=====!==!========!==============!===!=!===!=

a: AGAATTTAAACCCAGGAGTCAAATGGAAATTGA TTTCTTAGAATTAGCTATGGATGAATTCATTGAACGGTATAAATTA
b: GGATTTTAAGCCCAGATCACAAATGGAAACTGACTTTC TCGAGCTCGCTATGGATGAATTCATACAGCGATATAAGCTC
d: !==!=====!=====!!!!==========!=== ==== =!==!!=!=================!!=!==!=====!!=!

a: GAAGGCTATGCCTTCGAACATATCGTTTATGGAGATTTTAGTCATAGTCAGTTAGGTGGTTTACATCTACTGATTGGACT
b: GAGGGCTATGCCTTCGAACACATCGTTTATGGAGATTTCAGTCATGGACAACTTGGCGGTCTTCATTTAATGATAGGCTT
d: ==!=================!=================!======!=!==!!=!==!===!=!===!==!====!==!!=

a: AGCTAAACGTTTTAAGGAATCACCTTTTGAATTAGAAGATTTTATTCCTATGGACAGTACAGTTAAAAACTATTTCATAA
b: AGCCAAGCGCTCACAAGATTCACCACTTAAATTAGAGGATTTTATCCCTATGGACAGCACAGTGAAAAATTACTTCATAA
d: ===!==!==!=!!!=!==!=====!!==!=======!========!===========!=====!=====!==!=======

a: CAGATGCGCAAACAGGTTCATCTAAGTGTGTGTGTTCTGTTATTGATTTATTACTTGATGATTTTGTTGAAATAATAAAA
b: CAGATGCGCAAACAGGTTCATCAAAATGTGTGTGTTCTGTGATTGATCTTTTACTTGATGACTTTGTCGAGATAATAAAG
d: ======================!==!==============!======!=!===========!=====!==!========!

a: TCCCAAGATTTATCTGTAGTTTCTAAGGTTGTCAAAGTGACTATTGACTATACAGAAATTTCATTTATGCTTTGGTGTAA
b: TCACAAGATTTGTCAGTGATTTCAAAAGTGGTCAAGGTTACAATTGACTATGCTGAAATTTCATTCATGCTTTGGTGTAA
d: ==!========!==!==!!====!==!==!=====!==!==!=========!=!===========!==============

a: AGATGGCCATGTAGAAACATTTTACCCAAAATTACAATCTAGTCAAGCGTGGCAACCGGGTGTTGCTATGCCTAATCTT 
b: GGATGGACATGTTGAAACCTTCTACCCAAAACTACAAGCAAGTCAAGCGTGGCAACCAGGTGTTGCGATGCCTAA CTTG
d: !=====!=====!=====!==!=========!=====!=!=================!========!======== === 

a: TACAAAATGCAAAGAATGCTATTAGAAAAGTGTGACCTTCAAAATTATGGTGATAGTGCAACATTACCTAAAGGCATAAT
b: TACAAGATGCAAAGAATGCTTCTTGAAAAGTGTGACCTTCAGAATTATGGTGAAAATGCTGTTATACCAAAAGGAATAAT
d: =====!==============!!=!=================!===========!=!===!!!!!====!=====!=====

a: GATGAATGTCGCAAAATATACTCAACTGTGTCAATATTTAAACACATTAACATTAGCTGTACCCTATAATATGAGAGTTA
b: GATGAATGTCGCAAAGTATACTCAACTGTGTCAATACTTAAATACACTTACTTTAGCTGTACCCTACAACATGAGAGTTA
d: ===============!====================!=====!===!=!==!==============!==!==========

a: TACATTTTGGTGCTGGTTCTGATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAGACAGTGGTTGCCTACGGGTACGCTG
b: TTCACTTTGGTGCTGGCTCTGATAAAGGAGTTGCACCAGGTACAGCTGTGCTCAGACAATGGTTGCCAACTGGCACACTA
d: =!==!===========!================================!!=!=====!========!==!==!==!==!

a: CTTGTCGATTCAGATCTTAATGACTTTGTCTCTGATGCAGATTCAACTTTGATTGGTGATTGTGCAACTGTACATACAGC
b: CTTGTCGATTCAGATCTTAATGACTTCGTCTCCGACGCAGATTCTACTTTAATTGGAGACTGTGCAACAGTACATACGGC
d: ==========================!=====!==!========!=====!=====!==!========!========!==

a: TAATAAATGGGATCTCATTATTAGTGATATGTACGACCCTAAGACTAAAAATGTTACAAAAGAAAATGACTCTAAAGAGG
b: TAATAAATGGGACCTTATTATTAGCGATATGTATGACCCTAGGACCAAACATGTGACAAAAGAGAATGACTCTAAAGAAG
d: ============!==!========!========!=======!===!===!====!========!==============!=

a: GTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACAT
b: GGTTTTTCACTTATCTGTGTGGATTTATAAAGCAAAAACTAGCCCTGGGTGGTTCTATAGCTGTAAAGATAACAGAGCAT
d: =!===========!!=!=====!======!=!=====!=====!==!==!=====!!=!===!=============!===

a: TCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATC
b: TCTTGGAATGCTGACCTTTACAAGCTTATGGGCCATTTCTCATGGTGGACAGCTTTTGTTACAAATGTAAATGCATCATC
d: ==============!=====!=====!=====!==!===!=============!========!=====!=====!=====

a: ATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACC ACGCGAACAAATAGATGGTTATGTCATGCATGCAAAT
b: ATCGGAAGCATTTTTAATTGGGGCTAACTATCTTGGCAAGCCGAAG GAACAAATTGATGGCTATACCATGCATGCTAAC
d: ===!=================!!!===!===========!== =!= ========!=====!===!!=========!==!

a: TACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATT
b: TACATTTTCTGGAGGAACACAAATCCTATCCAGTTGTCTTCCTATTCACTCTTTGACATGAGCAAATTTCCTCTTAAATT
d: =====!==!========!========!==!=================!!=!===========!========!========

a: AAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTA
b: AAGAGGAACTGCTGTAATGTCTCTTAAGGAGAATCAAATCAATGATATGATTTATTCTCTTCTGGAAAAAGGTAGGCTTA
d: ===!==!========!======!=!==!==!!!====================!!========!!!!========!====

a: TAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGT
b: TCATTAGAGAAAACAACAGAGTTGTGGTTTCAAGTGATATTCTTGTTAACAACTAAACGAAC ATGTTT ATTTTCTTAT
d: =!=======================!!====!======!======================= ====== !=======!=

a: TTTATTGCCACTAGTCTCTAGT  CAGTG TGTTAATC TTACAACCAGAACTCA  A  TT  ACCCCCTGCATACACT
b: TAT TTCTTACT CTCACTAGTGGTAGTGACCTTGACCGGTGC ACCACTTTTGATGATGTTCAAGCTCCTAATTACACT
d: =!= ==!!!=== !==!=====  !==== !!==!=!= !=!= ====!!!!=!=  =  ==  =!=!===!!!======

a:   A ATTCTT  TC ACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATC CTCAGTTTTACATTCAACTCAGGACT
b: CAACATACTTCATCTATGAGGGGGGTTTACTATCCTGATGAAATTTTTAGATCAGACACTCTT TATTTAACTCAGGATT
d:   = ==!===  == =!!!=!==!=====!==!=====!!==!====!===== !!==!=!== !===!=========!=

a: T GTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGA
b: TATTTCTT CCATTTTATTCTAATGTTACAGGGTT   T C ATAC   TAT T      AA   T C  ATACGTTTGA
d: = !===== ==!==!=!===!========!!====   = = ====   =!= =      ==   = =  =!=!======

a: TAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTG
b: CAACCCTGTCATACCTTTTAAGGATGGTATTTATTTTGCTGCCACAGAGAAATCAAATGTTGTCCGTGGTTGGGTTTTTG
d: !=========!====!=====!======!===========!====!=====!==!==!!=!!=!!=!==!===!======

a: GTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTT
b: GTTCTACCATGAACAACAAGTCACAGTCGGTGATTATTATTAACAATTCTACTAATGTTGTTATACGAGCATGTAACTTT
d: ==!====!!=!!=!!!!===!=!=====!!=!!=====!====!==!!================!!!==!!===!=!===

a: CAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTA
b: GAATTGTGTGACAACCCTTTCTTTGCTGTTTCTAAAC CCATGGGTAC ACAGACACATACTATGATA TTC GA   TA
d: !====!===!=!!=!==!==!==!=!=====!=!=!= =!=!!!!!== =!==!!!!==!!!=!=!!= === ==   ==

a: TTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCA GCCTTTTCTTATGGACCTTGAAGGAAA ACAGGGTAATTT
b:     A TGCATTTAATTGCACTTTCGAGTACATATCTGATGCCTTTTC GCTTGATGTTTCAGAAAAGTCA GGTAATTT
d:     = ===!!!============!==!==!!=!===!= ======== !!=!==!!==!!==!=== !== ========

a: CAAAAATCTTA GGGAATTTGTGTTTAAGAATATTGATGGTTATTTTAAAATATATTCTAAGCAC A C GCCTATTAAT
b: TAAACA CTTACGAGAGTTTGTGTTTAAAAATAAAGATGGGT TTCT CTATGT TTATAAGGGCTATCAACCTATAGAT
d: !===!= ==== =!==!===========!====!!=====!= ==!= !!==!= ==!====!!= = = !=====!!==

a: TTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACC ATTGGTAGATTTGCCAATAGGTATTAACATCACTAGGT
b: GTAGTTCGTGATCTACCTTCTGGTTTTAACACTTTGAAACCTATTTTTA AGTTGCCTCTTGGTATTAACATTAC AAAT
d: !====!========!===!!!======!!!!====!!==== ===!!== =!=====!!=!===========!== =!!=

a: TTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCT
b: TTTAGA GCCA TT C TTAC  AG  CCT TTT  CACCTGCTCAAGACACTT  GG  GG CA CGTCAGCTGCAGCC
d: ==!=!= !!!= == = ====  ==  !!= ===  =!====!=!=!!!!!===  ==  == == =!!!!========!

a: TATTATGTGGGTTATCTTCAA CCTAGGACTTTTCTATTAAAATATAATGAAAATGGAACCATTACAGATGCTGTAGACT
b: TATTTTGTTGGCTAT TTAAAGCCAACTACATTTATGCTCAAGTATGATGAAAATGGTACAATCACAGATGCTGTTGATT
d: ====!===!==!=== ==!== ==!=!!==!===!=!!=!==!===!==========!==!==!===========!==!=

a: GTGCACTTGACCCTCTCTCAGAA ACAAAGTG TACGTTGAAATCCTTCACTGTAGAAAAAGGAATCTATCAAACTTCTA
b: GTTCTCAAAATCCACTTGCTGAACTCAAA TGCTCTGTTAAGAGCTTTGA GATTGACAAAGGAATTTACCAGACCTCTA
d: ==!=!=!!!=!==!==!!=!=== !==== == =!!===!=!=!=!==!= !!=!==!========!==!==!==!====

a: ACTTTAGAGTCCAACCAACAGAATCTATTGTTAGATTTCCTAATATTACAAACTTGTGCCCTTTTGGTGAAGTTTTTAAC
b: ATTTCAGGGTTGTTCCCTCAGGAGATGTTGTGAGATTCCCTAATATTACAAACTTGTGTCCTTTTGGAGAGGTTTTTAAT
d: =!==!==!==!!!!==!!===!=!!=!====!=====!====================!========!==!========!

a: GCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAA
b: GCTACTAAATTCCCTTCTGTCTATGCATGGGAGAGAAAAAAAATTTCTAATTGTGTTGCTGATTACTCTGTGCTCTACAA
d: ==!==!=!===!!=!=====!=====!===!=!==!==!=!===!!!!==!==============!=====!==!==!==

a: TTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTATG
b: CTCAACATTTTTTTCAACCTTTAAGTGCTATGGCGTTTCTGCCACTAAGTTGAATGATCTTTGCTTCTCCAATGTCTATG
d: !==!!===!!=====!==!========!=====!==!===!=!=====!==!========!=====!!=!==========

a: CAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTGATTATAATTAT
b: CAGATTCTTTTGTAGTCAAGGGAGATGATGTAAGACAAATAGCGCCAGGACAAACTGGTGTTATTGCTGATTATAATTAT
d: =======!======!=!=!!==!=====!==!========!==!=====!========!!!!==================

a: AAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAA
b: AAATTGCCAGATGATTTCATGGGTTGTGTCCTTGCTTGGAATACTAGGAACATTGATGCTACTTCAACTGGTAATTATAA
d: =====!===========!=!!==!==!==!!=!=========!===!!==!!=====!===!!!!!!!============

a: TTACCTGTATAGATTGTTTAG GAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCC GG
b: TTATAAATATAGGTATCTTAGACATGGC AAGCTTAGGCCCTTTGAGAGAGACATATCTAATG TGCCTTTCTCCCCTGA
d: ===!!!!=====!=!!!==== !=!=!= ==!==!=!!==!===========!==!==!=!== !!!==!==!!!== =!

a: TAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCA TATGGTTTCCAACCCACTAATGGT
b: TGGCAAACCTTGCACCCCACCT   GCTCTTAATTGTTATTGGCCATTA AATGATTATGGTTTTTACACCACTACTGGC
d: =!===!======!=!!!!!!!=   =!=!==========!=!!==!=== ===!= ========!!=!!======!===!

a: GTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAA
b: ATTGGCTACCAACCTTACAGAGTTGTAGTACTTTCTTTTGAACTTTTAAATGCACCGGCCACGGTTTGTGGACCAAAATT
d: !====!========!========!=====================!==!=======!==!==!===========!===!!

a: GTCTACTAATTTGGTTAAAAACAAATGTGTCAATTTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTA
b: ATCCACTGACCTTATTAAGAACCAGTGTGTCAATTTTAATTTTAATGGACTCACTGGTACTGGTGTGTTAACTCCTTCT 
d: !==!===!=!!=!!====!===!=!===========!==!==!=====!!=!==!==!==!=====!!=!===!!!=== 

a: ACAAAAAG TTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATGCTGTCCGTGATCCACAGACACT
b: TCAAAGAGATTTCAACCATTTCAACAATTTGGCCGTGATGTTTCTGATTTCACTGATTCCGTTCGAGATCCTAAAACATC
d: !====!== ====!!==!==!============!=!==!!==!====!!!!======!=!==!==!=====!!=!===!!

a: TGAGATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCAGGAACAAATACTTCTAAC CAGGTT
b: TGAAATATTAGACATTTCACCTTGCTCTTTTGGGGGTGTAAGTGTAATTACACCTGGAACAAATGCTTC ATCTGAAGTT
d: ===!==!!=!======!====!==!========!=====!=====!==!=====!=========!==== =!= !=!===

a: GCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTGGCGTGT
b: GCTGTTCTATATCAAGATGTTAACTGCACTGATGTTTCTACAGCAATTCATGCAGATCAACTCACACCAGCTTGGCGCAT
d: ========!=====!==============!==!==!!==!!!==!=================!==!==!!=======!!=

a: TTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGCTGAACATGTCAACAACTCATATGAGT
b: ATATTCTACTGGAAACAATGTATTCCAGACTCAAGCAGGCTGTCTTATAGGAGCTGAGCATGTCGACACTTCTTATGAGT
d: !========!==!!!!=====!==!==!==!=!!=========!=!=====!=====!======!===!!==!=======

a: GTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCTCCTCGGCGGGCACGTAGT GTAGC
b: GCGACATTCCTATTGGAGCTGGCATTTGTGCTAGTTACCATA  CAG  T  TTCT  T    TATTACGTAGTACTAGC
d: =!=====!==!=====!==!==!==!==!========!==!=  ===  =  ====  =    !!!!======= !====

a: TAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCAGAAAATTCAGTTGCTTACTCTAATAACTCTATTGCCATAC
b: CA AAAATCTATTGTGGCTTATACTATGTCTTTAGGTGCTGATAGTTCAATTGCTTACTCTAATAACACCATTGCTATAC
d: != !!====!==!!=!==!==!========!!=!=====!==!=!====!=================!=!=====!====

a: CCACAAATTTTACTATTAGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAAGACATCAGTAGATTGTACAATGTAC
b: CTACTAACTTTTCAATTAGCATTACTACAGAAGTAATGCCTGTTTCTATGGCTAAAACCTCCGTAGATTGTAATATGTAC
d: =!==!==!===!=!=====!!====!======!=!!=!==!==!======!=!==!==!==!==========!!======

a: ATTTGTGGTGATTCAACTGAATGCAGC AATCTTTTGTTGCAATATGGCAGTTTTTGTACACAATTAAACCGTGCTTTAA
b: ATCTGCGGAGATTCTACTGAATG TGCTAATTTGCTTCTCCAATATGGTAGCTTTTGCACACAACTAAATCGTGCACTCT
d: ==!==!==!=====!======== !== ===!=!!=!!=!========!==!=====!======!====!=====!!=!!

a: CTGGAATAGCTGTTGAACAAGACAAAAACACCCAAGAAGTTTTTGCACAAGTCAAACAAATTTACAAAACACCACCAATT
b: CAGGTATTGCTGCTGAACAGGATCGCAACACACGTGAAGTGTTCGCTCAAGTCAAACAAATGTACAAAACCCCAACTTTG
d: =!==!==!====!======!==!!!!=====!=!!=====!==!==!==============!========!===!=!!=!

a: AAAGATTTTGGTGGTTTTAATTTTTCACAAATATTACCAGATCCATC AAAACCAAGCAAGAGGTCATTTATTGAAGATC
b: AAATATTTTGGTGGTTTTAATTTTTCACAAATATTACCTGA CCCTCTAAAGCCAACTAAGAGGTCTTTTATTGAGGACT
d: ===!==================================!== ==!== ===!====!!========!========!==!!

a: TACTTTTCAACAAAGTGACACTTGCAGATGCTGGCTTCATCAAACAATATGGTGATTGCCTTGGTGATATTGCTGCTAGA
b: TGCTCTTTAATAAGGTGACACTCGCTGATGCTGGCTTCATGAAGCAATATGGCGAATGCCTAGGTGATATTAATGCTAGA
d: =!==!==!==!==!========!==!==============!==!========!==!=====!=========!!=======

a: GACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTTTTGCCACCTTTGCTCACAGATGAAATGATTGCTCAATACAC
b: GATCTCATTTGTGCGCAGAAGTTCAATGGACTTACAGTGTTGCCACCTCTGCTCACTGATGATATGATTGCTGCCTACAC
d: ==!===========!==!=====!==!==!=====!==!=========!=======!=====!=========!!!=====

a: TTCTGCACT GTTAGCGGGTACAATCACTTCTGGTTGGACCTTTGGTGCAGGTGCTGCATTACAAATACCATTTGCTATG
b: TGCTGCTCTAGTTAG TGGTACTGCCACTGCTGGATGGACATTTGGTGCTGGCGCTGCTCTTCAAATACCTTTTGCTATG
d: =!====!== ===== !=====!!!====!====!=====!========!==!=====!!=!========!=========

a: CAAATGGCTTATAGGTTTAATGGTATTGGAGTTACACAGAATGTTCTCTATGAGAACCAAAAATTGATTGCCAACCAATT
b: CAAATGGCATATAGGTTCAATGGCATTGGAGTTACCCAAAATGTTCTCTATGAGAACCAAAAACAAATCGCCAACCAATT
d: ========!========!=====!===========!==!========================!!!==!===========

a: TAATAGTGCTATTGGCAAAATTCAAGACTCACTTTCTTCCACAGCAAGTGCACTTGGAAAACTTCAAGATGTGGTCAACC
b: TAACAAGGCGATTAGTCAAATTCAAGAATCACTTACAACAACATCAACTGCATTGGGCAAGCTGCAAGACGTTGTTAACC
d: ===!=!!==!===!=!!==========!======!=!!=!===!===!====!=!==!==!==!=====!==!==!====

a: AAAATGCACAAGCTTTAAACACGCTTGTTAAACAACTTAGCTCCAATTTTGGTGCAATTTCAAGTGTTTTAAATGATATC
b: AGAATGCTCAAGCATTAAACACACTTGTTAAACAACTTAGCTCTAATTTTGGTGCAATTTCAAGTGTGCTAAATGATATC
d: =!=====!=====!========!====================!=======================!!===========

a: CTTTCACGTCTTGACAAAGTTGAGGCTGAAGTGCAAATTGATAGGTTGATCACAGGCAGACTTCAAAGTTTGCAGACATA
b: CTTTCGCGACTTGATAAAGTCGAGGCGGAGGTACAAATTGACAGGTTAATTACAGGCAGACTTCAAAGCCTTCAAACCTA
d: =====!==!=====!=====!=====!==!==!========!=====!==!=================!!=!==!==!==

a: TGTGACTCAACAATTAATTAGAGCTGCAGAAATCAGAGCTTCTGCTAATCTTGCTGCTACTAAAATGTCAGAGTGTGTAC
b: TGTAACACAACAACTAATCAGGGCTGCTGAAATCAGGGCTTCTGCTAATCTTGCTGCTACTAAAATGTCTGAGTGTGTTC
d: ===!==!======!====!==!=====!========!================================!========!=

a: TTGGACAATCAAAAAGAGTTGATTTTTGTGGAAAGGGCTATCATCTTATGTCCTTCCCTCAGTCAGCACCTCATGGTGTA
b: TTGGACAATCAAAAAGAGTTGACTTTTGTGGAAAGGGCTACCACCTTATGTCCTTCCCACAAGCAGCCCCGCATGGTGTT
d: ======================!=================!==!==============!==!!====!==!========!

a: GTCTTCTTGCATGTGACTTATGTCCCTGCACAAGAAAAGAACTTCACAACTGCTCCTGCCATTTGTCATGATGGAAAAGC
b: GTCTTCCTACATGTCACGTATGTGCCATCCCAGGAGAGGAACTTCACCACAGCGCCAGCAATTTGTCATGAAGGCAAAGC
d: ======!=!=====!==!=====!==!!=!==!==!=!=========!==!==!==!==!===========!==!=====

a: ACACTTTCCTCGTGAAGGTGTCTTTGTTTCAAATGGCACACACTGGTTTGTAACACAAAGGAATTTTTATGAACCACAAA
b: ATACTTCCCTCGTGAAGGTGTTTTTGTGTTTAATGGCACTTCTTGGTTTATTACACAGAGGAACTTCTTTTCTCCACAAA
d: =!====!==============!=====!=!!========!!!!======!=!=====!=====!==!=!=!!!=======

a: TCATTACTACAGACAACACATTTGTGTCTGGTAACTGTGATGTTGTAATAGGAATTGTCAACAACACAGTTTATGATCCT
b: TAATTACTACAGACAATACATTTGTCTCAGGAAATTGTGATGTCGTTATTGGCATCATTAACAACACAGTTTATGATCCT
d: =!==============!========!==!==!==!========!==!==!==!==!!=!=====================

a: TTGCAACCTGAATTAGACTCATTCAAGGAGGAGTTAGATAAATATTTTAAGAATCATACATCACCAGATGTTGATTTAGG
b: CTGCAACCTGAGCTTGACTCATTCAAAGAAGAGCTGGACAAGTACTTCAAAAATCATACATCACCAGATGTTGATCTTGG
d: !==========!!=!===========!==!===!=!==!==!==!==!==!========================!=!==

a: TGACATCTCTGGCATTAATGCTTCAGTTGTAAACATTCAAAAAGAAATTGACCGCCTCAATGAGGTTGCCAAGAATTTAA
b: CGACATTTCAGGCATTAACGCTTCTGTCGTCAACATTCAAAAAGAAATTGACCGCCTCAATGAGGTCGCTAAAAATTTAA
d: !=====!==!========!=====!==!==!===================================!==!==!=======

a: ATGAATCTCTCATCGATCTCCAAGAACTTGGAAAGTATGAGCAGTATATAAAATGGCCATGGTACATTTGGCTAGGTTTT
b: ATGAATCACTCATTGACCTTCAAGAATTGGGAAAATATGAGCAATATATTAAATGGCCTTGGTATGTTTGGCTCGGCTTC
d: =======!=====!==!==!======!=!=====!========!=====!========!=====!!=======!==!==!

a: ATAGCTGGCTTGATTGCCATAGTAATGGTGACAATTATGCTTTGCTGTATGACCAGTTGCTGTAGTTGTCTCAAGGGCTG
b: ATTGCTGGACTAATTGCCATCGTCATGGTTACAATCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGG TG
d: ==!=====!!=!========!==!=====!=====!!=======!==!=====!=====!==!=====!======== ==

a:  TTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAAGGAGTCAAATTACATTACACA
b: CATGCTCTTGTGGTTCTTGCTGCAAGTTTGATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACA
d:  !==!========!==!========!========!==!==============!=====!==!==================

a: TAAACGAACTTATGGATTTGTTTATGAGAATCTTCACAATTGGAACTGTAACTTTGAAGCAAGGTGAAATCAAGGATGCT
b: TAAACGAACTTATGGATTTGTTTATGAGATTTTTTACTCTTGGATCAATTACTGCACAGCCAGTAAAAATTGACAATGCT
d: =============================!=!==!==!!=====!=!!=!===!!!!===!==!!!====!!=!!=====

a: ACTCCTTCAGATTTTGTTCGCGCTACTGCAACGATACCGATACAAGCCTCACTCCCTTTCGGATGGCTTATTGTTGGCGT
b: TCTCCTGCAAGTACTGTTCATGCTACAGCAACGATACCGCTACAAGCCTCACTCCCTTTCGGATGGCTTGTTATTGGCGT
d: !=====!==!!=!!=====!!=====!============!=============================!==!=======

a: TGCACTTCTTGCTGTTTTTCAGAGCGCTTCCAAAATCATAACCCTCAAAAAGAGATGGCAACTAGCACTCTCCAAGGGTG
b: TGCATTTCTTGCTGTTTTTCAGAGCGCTACCAAAATAATTGCGCTCAATAAAAGATGGCAGCTAGCCCTTTATAAGGGCT
d: ====!=======================!=======!==!!=!=====!==!========!=====!==!=!!=====!!

a: TTCACTTTGTTTGCAACTTGCTGTTGTTGTTTGTAACAGTTTACTCACACCTTTTGCTCGTTGCTGCTGGCCTTGAAGCC
b: TCCAGTTCATTTGCAATTTACTGCTGCTATTTGTTACCATCTATTCACATCTTTTGCTTGTCGCTGCAGGTATGGAGGCG
d: =!==!==!!=======!==!===!==!=!=====!==!!=!==!=====!========!==!=====!==!!=!==!==!

a: CCTTTTCTCTATCTTTATGCTTTAGTCTACTTCTTGCAGAGTATAAAC TTTGTAAGAATAATAATGAGGCTTTGGCTTT
b: CAATTTTTGTACCTCTATGCCTTGATATATTTTCTACAATGCATCAACGCATGT AGAATTATTATGAGATGTTGGCTTT
d: =!!===!=!==!==!=====!==!!=!==!==!!=!==!!=!==!=== !!=== =====!==!=====!!!========

a: GCTGGAAATGCCGTTCCAAAAACCCATTACTTTATGATGCCAACTATTTTCTTTGCTGGCATACTAATTGTTACGACTAT
b: GTTGGAAGTGCAAATCCCAGAACCCATTACTTTATGATGCCAACTACTTTGTTTGCTGGCACACACATAACTATGACTAC
d: =!=====!===!!!===!=!==========================!===!==========!==!!==!!!==!=====!

a: TGTATACCTTACAATAGTGTAACTTCTTCAATTGTCATTACTTCAGGTGATGGCACAACAAGTCCTATTTCT GAACATG
b: TGTATACCATATAACAGTGTCACAGATACAATTGTCGTTACTGAAGGTGACGGCATTTCAACACC AAAACTCAAAGAAG
d: ========!==!==!=====!==!!!=!========!=====!!======!====!!!===!!== =!!!== !==!=!=

a: ACTACCAGATTGGTGGTTATACTGAAAAATGGGAATCTGGAGTAAAAGACTGTGTTGTATTACACAGTTACTTCACTTCA
b: ACTACCAAATTGGTGGTTATTCTGAGGATAGGCACTCAGGTGTTAAAGACTATGTCGTTGTACATGGCTATTTCACCGAA
d: =======!============!====!!=!!==!=!==!==!==!=======!===!==!!====!!=!==!=====!!!=

a: GACTATTACCAGCTGTACTCAACTCAATTGAGTACAGACACTGGTGTTGAACATGTTACCTTCTTCATCTACAATAAAAT
b: GTTTACTACCAGCTTGAGTCTACACAAATTACTACAGACACTGGTATTGAAAATGCTACATTCTTCATCTTTAACAAGCT
d: =!!==!========!!=!==!==!===!=!=!=============!=====!===!===!==========!!==!==!!=

a: TGTTGATGAGCCTGAAGAACATGTCCAAATTCACACAATCGACGGTTCATCCGGAGTTGTTAATCCAGTAATGGAACCAA
b: TGTTAAAGA CC CACCGA ATGTGCAAATACACACAATCGACGGCTCTTCAGGAGTTGCTAATCCAGCAATGGATCCCA
d: ====!=!== == !=!!!= ====!=====!==============!==!==!=======!========!======!==!=

a: TTTATGATGAACCGACGACGACTACTAGCGTGCCTTTGTAAGCACAAGCTGATGAGTACGAACTTATGTACTCATTCGTT
b: TTTATGATGAGCCGACGACGACTACTAGCGTGCCTTTGTAAGCACAAGAAAGTGAGTACGAACTTATGTACTCATTCGTT
d: ==========!=====================================!!!!============================

a: TCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGC
b: TCGGAAGAAACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTGCTAGTCACACTAGC
d: ========!==============================================================!========

a: CATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTCTTTTTACGTTT
b: CATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTTTAGTAAAACCAACGGTTTACGTCT
d: =======================================================!=!========!!=!!=======!=

a: ACTCTCGTGTTAAAAATCTGAATTCTTCT  A GAGTTCCTGATCTTCTGGTCTAAACGAACTAAATATTATATTAGTTT
b: ACTCGCGTGTTAAAAATCTGAACTCTTCTGAAGGAGTTCCTGATCTTCTGGTCTAAACGAACTAACTA T TATTA TTA
d: ====!=================!======  = ================================!== = ===== ==!

a: TTCTGTTTGGAACTTT A ATT  TTAGCCATGGCAGATTCCAACGGTACTATTACCGTTGAAGAGCTTAAAAAGCTCCT
b: TTCTGTTTGGAACTTTAACATTGCTTA TCATGGCAGA   CAACGGTACTATTACCGTTGAGGAGCTTAAACAACTCCT
d: ================ = ===  === !=========   =====================!=========!=!=====

a: TGAACAATGGAACCTAGTAATAGGTTTCCTATTCCTTACATGGATT TGTCTTCTACAATTTGCCTATGCCAACAGGAAT
b: GGAACAATGGAACCTAGTAATAGGTTTCCTATTCCTAGCCTGGATTATGT TACTACAATTTGCCTATTCTAATCGGAAC
d: !===================================!!=!====== === =!===============!=!==!!====!

a: AGGTTTTTGTATATAATTAAGTTAATTTTCCTCTGGCTGTTATGGCCAGTAACTTTAGCTTGTTTTGTGCTTGCTGCTGT
b: AGGTTTTTGTACATAATAAAGCTTGTTTTCCTCTGGCTCTTGTGGCCAGTAACACTTGCTTGTTTTGTGCTTGCTGCTGT
d: ===========!=====!===!=!!=============!==!===========!!=!=======================

a: TTACAGAATAAATTGGATCACCGGTGGAATTGCTATCGCAATGGCTTGTCTTGTAGGCTTGATGTGGCTCAGCTACTTCA
b: CTACAGAATTAATTGGGTGACTGGCGGGATTGCGATTGCAATGGCTTGTATTGTAGGCTTGATGTGGCTTAGCTACTTCG
d: !========!======!=!==!==!==!=====!==!============!===================!=========!

a: TTGCTTCTTTCAGACTGTTTGCGCGTACGCGTTCCATGTGGTCATTCAATCCAGAAACTAACATTCTTCTCAACGTGCCA
b: TTGCTTCCTTCAGGCTGTTTGCTCGTACCCGCTCAATGTGGTCATTCAACCCAGAAACAAACATTCTTCTCAATGTGCCT
d: =======!=====!========!=====!==!==!==============!========!==============!=====!

a: CTCCATGGCACTATTCTGACCAGACCGCTTCTAGAAAGTGAACTCGTAATCGGAGCTGTGATCCTTCGTGGACATCTT C
b: CTCCGGGGGACAATTGTGACCAGACCGCTCATGGAAAGTGAACTTGTCATTGGTGCTGTGATCATTCGTGGTCA CTTGC
d: ====!!==!==!===!=============!!=!===========!==!==!==!=========!=======!== === =

a: GTATTGCTGGACACCATCTAGGACGCTGTGACATCAAGGACCTGCCTAAAGAAATCACTGTTGCTACATCACGAACGCTT
b: GAATGGCCGGACACTCCCTAGGGCGCTGTGACATTAAGGACCTGCCAAAAGAGATCACTGTGGCTACATCACGAACGCTT
d: =!==!==!======!!!=====!===========!===========!=====!========!==================

a: TCTTATTACAAATTGGGAGCTTCGCAGCGTGTA GCAGGTGACTCAGGTTTTGCTGCATACAGTCGCTACAGGATTGGCA
b: TCTTATTACAAATTAGGAGCGTCGCAGCGTGTAGGCA CTGATTCAGGTTTTGCTGCATACAACCGCTACCGTATTGGAA
d: ==============!=====!============ === !===!===================!!======!=!=====!=

a: ACTATAAATTAAACACAGACCATTCCAGTAGCAGTGACAATATTGCTTTGCTTGTACAGTAAGTGACAACAGATGTTTCA
b: ACTATAAATTAAATACAGACCACGCCGGTAGCAACGACAATATTGCTTTGCTAGTACAGTAAGTGACAACAGATGTTTCA
d: =============!========!!==!======!!=================!===========================

a: TCTCGTTGACTTTCAGGTTACTATAGCAGAGATATTACTAATTATTATGAGGACTTTTAAAGTTTCCATTTGGAATCTTG
b: TCTTGTTGACTTCCAGGTTACAATAGCAGAGATATTGATTATCATTATGAGGACTTTCAGGATTGCTATTTGGAATCTTG
d: ===!========!========!==============!!=!==!==============!=!!!==!=!=============

a: ATTACATCATAAACCTC ATAATTAAAAATTTATCTAAGTCACTAACTGAGAATAAATATTCTCAATTAGATGAAGAGCA
b: ACGTTATAAT AAGTTCAATAGTGAGACAATTATTTAAGCCTCTAACTAAGAAGAATTATTCGGAGTTAGATGATGAAGA
d: =!!!!==!== ==!!== ===!=!=!=!=!====!====!=!======!====!==!=====!!=!========!==!!=

a: ACCAAT G G  AGA T T GATTAAACGAACATGAAAATTATTCTTTTCTTGGCACTGATAACACTCGCTACTTGTGAG
b: ACTTATGGAGTTAGATTATCCATAAAACGAACATGAAAATTATTCTCTTCCTGACATTGATTGTATTTACATCTTGCGAG
d: ==!!== = =  === = = !==!======================!===!==!==!====!!!=!=!!=!!====!===

a: CTTTATCACTACCAAGAGTGTGTTAGAGGTACAACAGTACTTTTAAAAGAACCTTGCTCTTCTGGAACATACGAGGGCAA
b: CTATATCACTATCAGGAGTGTGTTAGAGGTACGACTGTACTACTAAAAGAACCTTGCCCATCAGGAACATACGAGGGCAA
d: ==!========!==!=================!==!=====!!==============!=!==!=================

a: TTCACCATTTCATCCTCTAGCTGATAACAAATTTGCACTGACTTGCTTTAGCACTCAATTTGCTTTTGCTTGTCCTGACG
b: TTCACCATTTCACCCTCTTGCTGACAATAAATTTGCACTAACTTGCACTAGCACACACTTTGCTTTTGCTTGTGCTGACG
d: ============!=====!=====!==!===========!======!!======!==!===============!======

a: GCGTAAAACACGTCTATCAGTTACGTGCCAGATCAGTTTCACCTAAACTGTTCATCAGACAAGAGGAAGTT   CAAGAA
b: GTACTCGACATACCTATCAGCTGCGTGCAAGATCAGTTTCACCAAAACTTTTCATCAGACAAGAGGAGGTTCAACAAGAG
d: =!!!!!!===!!!=======!=!=====!==============!=====!=================!===   =====!

a: CTTTACTCTCCAATTTTTCTTATTGTTGCGGCAATAGTGTTTATAACACTTTGCTTCACACTCAAAAGAAAGACAGAATG
b: CTCTACTCGCCACTTTTTCTCATTGTTGCTGCTCTAGTATTTTTAATACTTTGCTTCACCATTAAGAGAAAGACAGAATG
d: ==!=====!===!=======!========!==!!====!===!===!============!!=!==!==============

a: ATTGAACTTTCATTAATTGACTTCTATTTGTGCTTTTTAGCCTTTCTGCTATTCCTTGTTTTAATTATGCTTATTATCTT
b: AATGAGCTCACTTTAATTGACTTCTATTTGTGCTTTTTAGCCTTTCTGCTATTCCTTGTTTTAATAATGCTTATTATATT
d: =!===!==!!=!=====================================================!===========!==

a: TTGGTTCTCACTTGAACTGCAAGATCATA ATGAAACTTGT  C ACGCCTAAACGAACATGAAATTTCTTGTTTTCTTA
b: TTGGTTTTCACTCGAAATCCAGGATC TAGAAGAACCTTGTACCAAAGTCTAAACGAACATGAAACTTCTCATTGT TT 
d: ======!=====!===!=!==!==== == =!===!=====  = =!=!================!====!!==!= == 

a: GGAATCATCACAACTGTAGCTGCA TTTCACCAAG AATGTAGTTTACAGTCATGTAC TCAACATCAACCATATGTAGT
b: TGACTTGT ATTTCTCTA  TGCAGTTGCA TACGCACTGTAG  TACAGCGCTGTGCATCTA ATAAACCTCATGTGCT
d: !==!=!!= =!!!==!==  ==== ==!== !=!= =!=====  =====!!!===!= ==!= ==!====!!====!!=

a: TGATGACCCGTGTCCTATTCACTTCTATTCTAAATGGTATATTAGAGTAGGAGCTAGAAAATCAGCACCTTTAATTGAAT
b: TGAAGATCCTTGT  AAGGTACAAC A  CT  A GG       G GTA  A  TA CTTAT AGCA C TGCTTGGCTT
d: ===!==!==!===  !=!!!==!!= =  ==  = ==       = ===  =  == !!!== ==== = =!!!=!=!!=

a: TGTGCGTGGATGAGGCTGGTTCTAAATCACCCATTCAGTACATCGATATCGGTAATTATACAGTTTCCTGTTTACCTTTT
b: TGTGC TCTA G GAAAGGTTTTACCT TTTCATAGATGGCA CACTAT GGT  TCAAACA  TGCACACCTA ATGTT
d: ===== =!!= = =!!!====!==!!= !!!===!!=!!!== =!!=== ===  =!=!===  =!=!!!!!== !=!==

a: ACAATTAATTGCCAGGAACCTAAATTG GGTAGTCTTGTAG T  GCGTT GTTCGTTCTATGAAGACTTTTTAGAGTAT
b: ACTATCAACTGTCAAGATCC AGCTGGTGGTGCGCTTATAGCTAGGTGTTGGTACCTTC ATGAAG GTCACCAAACT G
d: ==!==!==!==!==!==!== =!!=!= ===!!!===!=== =  =!=== ==!=!=== ====== !=!!!!=!=!= !

a: CATGACGTTCGTGTTGT  TT TAGATTTCATCTAAACGAACAAACTAAAATGTCTGATAATGGACCCC A  AAATCAG
b: C TGCATTTAGAGACGTACTTGTTG TTTTAAATAAACGAACAAATTAAAATGTCTGATAATGGACCCCAATCAAACCAA
d: = ==!!!==!=!=!!==  == =!= ===!=!!============!======================= =  ===!==!

a: CGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCG
b: CGTAGTGCCCCCCGCATTACATTTGGTGGACCCACAGATTCAACTGACAATAACCAGAATGGAGGACGCAATGGGGCAAG
d: ==!=!===!===========!============!============!==!==============!=====!======!!=

a: ATCAAAACAACGTCGGCCCCAAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAG
b: GCCAAAACAGCGCCGACCCCAAGGTTTACCCAATAATACTGCGTCTTGGTTCACAGCTCTCACTCAGCATGGCAAGGAGG
d: !!=======!==!==!======================================!===========!===========!=

a: ACCTTAAATTCCCTCGAGGACAAGGCGTTCCAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGA
b: AACTTAGATTCCCTCGAGGCCAGGGCGTTCCAATCAACACCAATAGTGGTCCAGATGACCAAATTGGCTACTACCGAAGA
d: =!====!============!==!===========!===========!!================================

a: GCTACCAGACGAATTCGTGGTGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGG
b: GCTACCCGACGAGTTCGTGGTGGTGACGGCAAAATGAAAGAGCTCAGCCCCAGATGGTACTTCTATTACCTAGGAACTGG
d: ======!=====!================!===========!=====!==!========!=====!==============

a: GCCAGAAGCTGGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAA
b: CCCAGAAGCTTCACTTCCCTACGGCGCTAACAAAGAAGGCATCGTATGGGTTGCAACTGAGGGAGCCTTGAATACACCCA
d: !=========!!=========!==!===========!======!==================================!=

a: AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAA
b: AAGACCACATTGGCACCCGCAATCCTAATAACAATGCTGCCACCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAA
d: ====!=====================!!============!=!=====================================

a: GGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAA
b: GGCTTCTACGCAGAGGGAAGCAGAGGCGGCAGTCAAGCCTCTTCTCGCTCCTCATCACGTAGTCGCGGTAATTCAAGAAA
d: ==============!==!=============================!==================!!!=!=========

a: TTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGC
b: TTCAACTCCTGGCAGCAGTAGGGGAAATTCTCCTGCTCGAATGGCTAGCGGAGGTGGTGAAACTGCCCTCGCGCTATTGC
d: =========!================!==========!========!==!!!==!=====!!====!==!==!!=!!===

a: TGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAA
b: TGCTAGACAGATTGAACCAGCTTGAGAGCAAAGTTTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAA
d: ====!===========================!=!=============================================

a: TCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCA TACAATGTAACACAAGCTTTCGGCA
b: TCTGCTGCTGAGGCATCTAAAAAGCCTCGCCAAAAACGTACTGCCAC AAAACAGTACAACGTCACTCAAGCATTTGGGA
d: ==============!=====!========!================= ===!== =====!==!==!=====!==!==!=

a: GACGTGGTCCAGAACAAACCCAAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCG
b: GACGTGGTCCAGAACAAACCCAAGGAAATTTCGGGGACCAAGACCTAATCAGACAAGGAACTGATTACAAACATTGGCCG
d: ===============================!========!==!====================================

a: CAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAAC
b: CAAATTGCACAATTTGCTCCAAGTGCCTCTGCATTCTTTGGAATGTCACGCATTGGCATGGAAGTCACACCTTCGGGAAC
d: =================!==!==!==!==!==!=====!========!================================

a: GTGGTTGACCTA CACAGGTGCCATCAAATTGGATGACAAAGATCCAAATTTCAAAGATCAA GTCATTTTGCTGAATAA
b: ATGGCTGACTTATCA TGGAGCCATTAAATTGGATGACAAAGATCCACAATTCAAAGA CAACGTCATACTGCTGAACAA
d: !===!====!== == !==!=====!=====================!=!======== === =====!!=======!==

a: GCATATTGACGCATACAAAACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGCTGATGAAACTCAAGCC 
b: GCACATTGACGCATACAAAACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAAAAGACTGATGAAGCTC AGCCT
d: ===!=====================================================!===!========!=== ==== 

a: TTACCGCAGAGACAGAAGAAACAGCAAACTGTGACTCTTCTTCCTGCTGCAGATTTGGATGATTTCTCCAAACAATTGCA
b: TTGCCGCAGAGACAAAAGAAGCAGCCCACTGTGACTCTTCTTCCTGCGGCTGACATGGATGATTTCTCCAGACAACTTCA
d: ==!===========!=====!====!!====================!==!==!!===============!====!=!==

a: ACAATCCATGA  GCAG    TGCTGACTCAACTCAGGCCT AA ACTCATGCAGACCACACAAGGCAGATGGGCTATAT
b: AAATTCCATGAGTGGAGCTTCTGCTGATTCAACTCAGGCATAAACACTCATGATGACCACACAAGGCAGATGGGCTATGT
d: =!=!=======  =!==    ======!===========!= == =======!!========================!=

a: AAACGTTTTCGCTTTTCCGTTTACGATATATAGTCTACTCTTGTGCAGAATGAATTCTCGTAACTACATAGCACAAGTAG
b: AAACGTTTTCGCAATTCCGTTTACGATACATAGTCTACTCTTGTGCAGAATGAATTCTCGTAACTAAACAGCACAAGTAG
d: ============!!==============!=====================================!=!===========

a: ATGTAGTTAACTTTAATCTCACATAGCAATCTTTAATCAGTGTGTAACATTAGGGAGGACTTGAAAGAGCCACCACATTT
b: GTTTAGTTAACTTTAATCTCACATAGCAATCTTTAATCAATGTGTAACATTAGGGAGGACTTGAAAGAGCCACCACATTT
d: !=!====================================!========================================

a: TCACCGAGGCCACGCGGAGTACGATCGAGTGTACAGTGAACAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTAATG
b: TCATCGAGGCCACGCGGAGTACGATCGAGGGTACAGTGAATAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTAATG
d: ===!=========================!==========!=======================================

a: TGTAAAATTAATTTTAGTAGTGCTATCCCCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAA
b: TGTAAAATTAATTTTAGTAGTGCTATCCCCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAA 
d: =============================================================================== 

a: AAAAAAAAAAAAAAA
b:                
d: